Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:300C12   

TH:300C12RNAiTH:300C12
PCR_productTH:300C12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR74.2 Source_evidenceePCR842WS150 Sequence/Annotation Release
Overlaps_Gene R74.2 Source_evidenceePCR842WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII41875354189188
Overlaps_transcriptR74.2 Source_evidenceePCR842WS150 Sequence/Annotation Release
WB_DNA_textTH:300C121654tccaatgaaggccaatttatcaagttggacacacacattggtcagattacaacaagtgggattacactcaacatcactttctccttgctataaataccggctgacagactttaatagtgacttgagataggttcttcgctggacgaacttgactcgatttgtattaattcatctaaatttctcaaagcagaatgttccgaaatctagattttagtaaaatagccatatttaactaaatatgtttccataaatcttctgaaattctcccaatttttaattgttttttaaccaaaattttaataccaaaaaatttaaacatcttcttaatagaaggtacacaatagatcatatattttcatagtgatactactgattaacccaggcaaaacatgatatatcctaattcgcaatatacaaaaaaaaacattccttatctccgaaaatttccagttctaatttcacttattgcgcaaccatggacgtccgtcgtcttcatcactttctcaccttgttgtatatcactacgcaacaaacttatataattttacccgatatgccaagaaccagatctgtttgaggcagatgatgtccagctatttgaaggttttgttacacttctagtcaacccgattttgggagtatttaacgacgatggagattgaccgattttaacaatcttacacacttctagatgaggagatctattatttttctagcggcgatttgtggggtcacgttggctgaaagaaaggtgagttactttggacaattcgtacctacgaatatggataatttttaggcaagacaggataatgttggtgacgattattctgatttttcatctcaaccggtcaagaatgctggtgccaaccataatttgaaacaagtaacctactcaacaatcgcaccgaaattcgatattccaactcgtgcaccacttttgaacccaaatccgattggacgcaatcagaatcccgttcaaactaccacaaagaggccagttgtcgcctatagaagagggtatttcttccagcattacccatgggataggcttccaagaagatatcttcttcgtccaggaatgacatatgtatatccaccacagtacacattcgcaacctaccgttatccacatctgccatacaccgaccactacagtatctaccgtactcatccaggaatcggttccggctgtggaggaggtgggtgtggtggcggatatccacagggttacggtagctatgctggttatggaaacagtggaggatgtggaggtggaagtggcaccggatgcgggggttataacgatgatgaagacgaggattcatatgaagacagcgatgaggagaatggaaagagtggagaagcaaagatcaacaagaaggatccattggaagatttggagctggaagatttggaaaaactatcaaaatctgatgacacaaaatctggaacttctgaggcagtcacttctgatgatgttgatgttgaaccaactgagattaaaaaatcaaagttaggagatgatgaggacctgattgacgatcgaaaaaaaaaagcaaaaagaaacttcctcgtcaagtgggcttaattaactaagaatttcactatttttgttaaaattattatttattttttgttattgaggatctca