Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:300D2   

TH:300D2RNAiTH:300D2
PCR_productTH:300D2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH38K22.1 Source_evidenceePCR919WS150 Sequence/Annotation Release
Overlaps_Gene H38K22.1 Source_evidenceePCR919WS150 Sequence/Annotation Release
Chunk_score Abs_score814
Max_abs_score814H38K22.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII43073194309356
Overlaps_transcriptH38K22.1 Source_evidenceePCR919WS150 Sequence/Annotation Release
WB_DNA_textTH:300D22038aatcgcctttcttttcaattatctcactgagcaaatcaatgaaattttgagcagctttttccattcttcgtttatcttcggttgatggtataagtgggtagacagttagcacttttgttgcgaattttgctgcgtaaacctgaaaagaaaaacaatttcaccagcaaaaaaataaagtaagaaaaactggttcttgtagttttttttttgagtttttttcccttttatagttaatttccaattttcaataattccttcaaaaaattacctttgccatagcatactttggccatggttgtttttcaatatgcattaattcattaaattccactggatcatcatttccatgcattgaagatgttaaaatcattggtccaattttttcagattcaacaacatccataacttgaggtaaataatatgaaatatcgcatcggaaaatttcaccgagtacttgaaatgcattagctgctccttgagattcaatatagagtcggctaattagttgctggaaattagaaaaatattggagctcgtgggattttatttaaactcacttcaatttggtcatcgaaaaattcgataaccttttcttttccgagaataaatgaaagaagacgggtggctagtttacagcttctgcgaagttctggttcctctctcattacaagatctgaaaaaaagtggatattttaaaaatatttataaattttttgcgaattttcagctctaaaaaaatcgtgttttaattaattgttataacttcgaagccgagtttcaaatttttgtaagtgggaattttgattatggcaaattattgtattaatttttacgcgaatttttcctcaaaaccttcaatattttcgcttttgataaacaaaacaacttcaaaaacgttttatgaaaaatagcaattttttaaattaataaacgagaaaatccgaggtttttttcagaacaaattaagcatttttgagctgaaattcgttttaaaaagtatattgaaatttattaaagagttaaattttggcaattcgcaaaaaaattattttgtgttttgcaaatattaaaaaatcaacaaaaaaaatgttcgaaaattcgtacatttttcgtttctctttctttttttctttttttaatttttccgatcagttctctgaaattgaatatttgaaattatttgggaaaaatacccttaagatcctttccaagcaacaaaaaccatttttccttgtgtgtcgcctcattctccaatttatttctaaaatgtgaattagcgaaaatcttgctcaacacgtgaagagctgcttcaatggcaattggttcttcggacgcgagaattttcgagcgaatttcttcaataatctgttcatcagcaaaaagatatccaaaattatcagtgaatatctttaaaaggctcaaatccttctcaaaacagttttctgcccatttctttagatcaactttggcgcatacggtatccgaaaccaggtggattatttcctgcaaaaaaagttttattttaagtgcccagatactttttgaaaaattttcagcgaaaattgttcgtaatagtcatttttctttaaattttcgagtagaaaaacacagaaaaatatcacgaaaactagttttcacatagtttttcggtaaataggaaggtagattttttttggaaaaaaaaacatttttcttacacataaaataatctttcactcgaaaaatcggagaaatactaagataaaagttagaaaaatagtttttatatttaaaaaaaattccgcaaattttatgtaattttatgagcgcggtaattcaaattggccaaaaccattggaatttttttttcatatttaatgattttttttttcgtttttgtgtggaatctcggagaaattttcagatggaaatctcacttttgcagttggaacatcaaaagaaagtggtacaattcgatcaataaaatgacggaaaactgtctgctgagccttcgagctgattttcttctccattattgcttgtaacgctccctgaaatt