Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:300E12   

TH:300E12RNAiTH:300E12
PCR_productTH:300E12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR74.7 Source_evidenceePCR930WS150 Sequence/Annotation Release
Overlaps_Gene R74.7 Source_evidenceePCR939WS150 Sequence/Annotation Release
Chunk_score Abs_score834
Max_abs_score834R74.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII42043854205565
Overlaps_transcriptR74.7 Source_evidenceePCR939WS150 Sequence/Annotation Release
WB_DNA_textTH:300E121181cgaaacattttgcagctttaaataatgggaaaaacatctcgtgacaaaagggacatttactatcgtctggcaaaggagaacaaatggcgagcacggagtgcattcaaattgatgcagattgatgatgaatttcagattctgaaaggtgataaaataagctgaatggttcttaataaatgttaataaatgccaggagtccgtcgagctgtagatttgtgtgcagcacctggaagttggtcacaagtgctatcgaaaaggttatacgaggaagatcaagaggcaaaaattgttgcgattgatcttcagccgatggcaccgattccaggagttattcaacttcaaggagatattacttccgttgatacagctaatcaggtaagttatttgcatagaaaattcttctctgaaacctgaaacaagaacttaaaaatacaaactttccaggtcatcaaacacttttccggagaaaaatcagatattgtgatttgcgacggagccccagatgtaaccggaattcattctctggacgaattcatgcaagccgaactaatcctcgctgccttcaacatcacaagtcacgttctcaaagaaggcggcaactttctcgcgaaaattttccgatcccgaaactcctctcttctctatgcacaaatgaagaagtattttaaaaaagtatatctagccaaaccacgaagttcccgtcaatccagttgtgaagcttttgtcctgtgtctcgactattcaccgcccgagggatttgttccaacaatgggaaagacttcattagacgcaactgatgcttctgctatttcacctgatattatcgatggattcgtgacttgtggcgatctaagtggatgggacagcgagaagtcttatccgttggatattgatgcttgttttcccaaaggagagattgatgaagagcagaaaaagtaaataaatttattttatggagattttattttaaaaaaaacaaaaatttcagacgatacgagttcaaagacgtcgttcagccaccaacagatcctgcctacaaagcagctctcgataagaagaaaagtggagtttttgcaaaaatgtctgcagatttgaacagacaggtacttcaagcttcaagtaacaacaaaatatttagtttttgaaattgattttttaagctgaaagctgaacttagtcgt