Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:300F11   

TH:300F11RNAiTH:300F11
PCR_productTH:300F11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST02C12.2 Source_evidenceePCR753WS150 Sequence/Annotation Release
Overlaps_Gene T02C12.2 Source_evidenceePCR753WS150 Sequence/Annotation Release
Chunk_score Abs_score669
Max_abs_score669T02C12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII40208254021882
Overlaps_transcriptT02C12.2 Source_evidenceePCR753WS150 Sequence/Annotation Release
WB_DNA_textTH:300F111058attgtccttatcgttgatgcactgatgccatacaatcgagaacttttatcttctgaacttcggagctcgcgacttttgaagccaatgaccaagtttcttgttcgtggagacacccttctttcggatttacggcagaaatttgtatgattttttgaatttaaaacacacattaaatatttaattttttttaaactttcaggtatgtcaaagtgatacaattgttccattggagaatggtttggagctggatccaccgaatttggataatgcaaccgcagttcgatttccatcatcatttatatttgttcatgataccttttatgtggatatgccacccaatgcaattgacatttcacagtaattagtaattttctttagaaaaatgtttaaaaacatttttcagcccaatccgcaactttatgcttcaccgcgagatttatgatccagtggaggcttgtagtatggaaggagtcagaattattgacctgaagctgcgtctagggcagccgtacatattccagcattctgggaattgtgaacatctactcgtttttcatgatttgcgacttcttcatgaatcggacccgtggggaatcgataaatatccattcaccttatacgagaagggaaatgaaaagaaatgtgatatttgtaaaaaagggcatgtggagtaagtttaattcgcaaaaattattgtttttcctcaaagtaaattaatttaaaattttacatttccagattcgtcgtcgaacgccacgagcttcttcccaacacctacacacacttctgcaggacatgcttccaggagttcaactatgtgcatggtgtcaagacgcattcattcattgcttggccgtatacagaactacagactggagagcaaagaggatggccgtttggagattttgaacaagaagatgattgaaataattttgatatttatttctatttattttgcaaaaactttatgtttttactggtattttttatagaaaaaaggaaatgctggacatttaaaaattttattgttcttttttaattggatttcatctgattgg