Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:301G1   

TH:301G1RNAiTH:301G1
PCR_productTH:301G1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0284.4 Source_evidenceePCR827WS150 Sequence/Annotation Release
Overlaps_Gene B0284.4 Source_evidenceePCR827WS150 Sequence/Annotation Release
Chunk_score Abs_score764
Max_abs_score764B0284.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII43861204388035
Overlaps_transcriptB0284.4 Source_evidenceePCR827WS150 Sequence/Annotation Release
WB_DNA_textTH:301G11916ataatttggtggatgcaaagaaaatggtttggttttttagaagtagcttcatttagagtagcaatttcagcttgagaacactcaaaatcaatttaatgatgacaaaataggatatcatgagaaaaaggttcaacaaatgaatgaaaacgcatcgaaaatcgagcttctggtctctcaaactactaatctggttctagagcaagagaaaaatgatatcgttcacaaattggcgatacaaggaatggaacaaagaactattctgaataggggagctattattcaggcacagagcctagattcagttgaacgtgaattcattgatgcagttaattctacaagacaaaaaggaaatgaagttgctaattctatttcacgtatgggatcttatgcctttcaacttaaaccggaagatccggtttggtcgcggacgtcgcaagttgcatattgtaaggtaagtattggagatttttggcacattcctaaaggcctaaaggctctctaaaaatggattttgtttggtttcacctagaagattcaggaacatcagttgatttactgaagcatgaaaaattgcttcaacgtaacgtcgaaaaccattcagaatttgctgaaaaattaagaaaatttttacaacctccgggaaacttctggtgaaattgaaagaatttttttgtttctgaaatatttcaggcgtttcttgaacttttgaagttttttcggctcatccagaaaatcgcaaatcttgtcaaaaaagtacaaagttttcctaagcttttcccttctcaaatccccaactcaatacatcttcagaagaaacaaactatttattatgctacagtaatcctatagttattctacagtaccccgacccatcctactgtagagttactgtagttttgggaaaaacaatcagtattatctatctaatggcatattagaacttgctgagaacttaaaaaagttactgaaaaatagctcaaacgcgtaatgaacaatatgaaaattcaattttttgatttaaaatttattaaaaatgcagaaaaattctcctgattctaactttgagtaaggttttgagcaatttctcaaatattccactctcactaaattcatattcagaaagtagaaacaatttcttgtaaagattaaaacaattattttctgcaaaagttacataatttttgcagaaggaaattcaaaaagtggacttgctgctggaagttttgagtgacaatactgaagaaatatctaaacagcgtgaaaatcgaaaccaggaagttctccgatgtcatgctgttgcttgtctcattcagaatgctatcaccaccgtaagaaactctctcaatcaatttggagcttcattacaggaaaatacatttacaaattgtattgggtattacacagatctacttgagaagaacaagactctaactgatgtaattgtccagttaccagcagtgtctcgatctaaccatacaacaagtgccataatgtacagctctcagagatttgctattgatgttcaaaatgatcgcctggctcttgagcagaaaggtcagctggctcttcagaatatgatcaatggaaatggaggaaataccacttaaaacttttgaaaaatgttatataattccaaatgtattgtatttttattttcattttgaatctgaaaataagaaaaaacgttttatagagtccgacatctcctggttttacgaaaatcggtagatttcgggtgctgtaaaaaattttttggcagattttattgtattcttccaatttttacatctgtaacttaatttatcttttttctaaaataaaaacatgttttcgcataataaagaaaagtgttcatgtaagcaggcaggcaagcattcggtaggcatgaggttagcctgatggcaggcaggtatagt