Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:301H5   

TH:301H5RNAiTH:301H5
PCR_productTH:301H5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF21H11.2a Source_evidenceePCR1804WS150 Sequence/Annotation Release
Overlaps_Gene F21H11.2 Source_evidenceePCR1804WS150 Sequence/Annotation Release
Chunk_score Abs_score1742
Max_abs_score1742F21H11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII51134215115544
Overlaps_transcriptF21H11.2a Source_evidenceePCR1804WS150 Sequence/Annotation Release
WB_DNA_textTH:301H52124tattctccgccttctggacacacaaatcggcaaaccactcatgatgtcttcgattcaaaatcgtggaaaagagccagatgagttgattagtggagatgcaaagccaaagcttgatctgttccgaacttgtattgctgcgattccaagacttcttcctgatccgatgagtcatgtggtaagcctcgatagtgaagaaaaagtttccaaaactcagtatttcaggatttgatcgatctccttactcgccttacagttcatctcgatgaagagcttcgtaacatgtctggaatcacacttcaaacaattatcggagaatttcctgattggagagaacaagtgtttatcagtcacatctcgctcattcaatctcatatttatgatttctttccacaaattttggatgattcccttcgtttgatgctccaatctttgacaacatggaaaactgcaatcactgccgaaaagaagcgagaagccgagaaaattattccgacaagtccgccaagttgtcactcaagtcatgtgacaagtaatagtacccacagtactcacatctcggtcagcttccccaatactgtcacatcagcatcttcgattctttccaattcatcatcaccacatcaaccaacaccttcactgtgttctttaccagaatcttcatctcttcattcaattccaactgcaatgacatcactttcaacaacaactactccaactcattcacaaggtgctccatcaacatctactccaatcggaggtagtggtaacagtaccttgtcggttttgcatcaaatggaaggattggccattgtgtatctatgtcagactcgatcaaatccacgtgctatcgctgtcaagattttgaaagaaattcaactgatctatgatcttcttggaatcgagatgattgatacaccggtcattgatgtgctcgaccaggcaactccatatgttgtgaaaaagtatatcgaacacgtgcctatcaaagaacgaatgtcatggaatatggacttttcgtcggtttgtgataagatctcgacgatcgaaacggacaatactttggtgaacagtgatcgtggaaacgagtacttccaatgggatccgtggggttgtgcactttcgggttatgcagagataaagcacttgctcacaaaatgcccaagtgcagttgctgcagcgtggccaatacttttctcgagattaaatgcagtttcaggatatgttgatccgaagtgagcttaataaacaatatttcatgcttaaaaatatccatgcctgcctgcctacctgactattttttgaaatgtacagagttacggatttttcattttcaatttcttgaaagtgaatagaaattaaaaaagaagttcacttgtaccttggcaggcgtaagtcgctttggaggaatgtaggcagccattttatacctacccataaatgtctataaatatcaaactaatattctattgttacagtaacccacaaaacgaaagtcgttcatctcttctccgtgggtcaaaaagtaaaggaacttcatcgattctcggcgagcaacttggacaagaagcatgtcttgctctctggcaaaaatatctcattatgtgctgcgctttggctccggctccatacaatctctcacagcgaagcttcagtccaaccaactcaatggatggtccagttgatgtgtttcgatctgtgtctgcgtcactcagatcttcaagaactccagttccaaactcattatctcaattgatttcaaaagtttgtatgattttgagatgggaaaacttgactgacattcgtgatagtgttgtacttggagttggttctatcaatccactcgcctttgatatgatgcttgaagagttaaaatcaaatgggatccttcgagaagctacagaaaagaaggcagagacaaatttacgaagaagaaagcgaaaggatttattgagacttcaaattattcgagtaattgaagttgccatatttcgaggacttttattagttcattcggctggaagttcagatttcattctacatccacatgttgttgattttattgattcgatgagggtcaatttggagagcgatcatgtaagtggagaccttattgggattcatgat