Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302D2   

TH:302D2RNAiTH:302D2
PCR_productTH:302D2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26A5.1 Source_evidenceePCR1192WS150 Sequence/Annotation Release
Overlaps_Gene T26A5.1 Source_evidenceePCR1192WS150 Sequence/Annotation Release
Chunk_score Abs_score1003
Max_abs_score1003T26A5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64732376475403
Overlaps_transcriptT26A5.1 Source_evidenceePCR1192WS150 Sequence/Annotation Release
WB_DNA_textTH:302D22167aggaattgcaaaaactggaagaactattatttgtacaattcatcagccgtcttctcaattgtatcaaatgtttcatagagtcatttatttaggtaagcacgttatagtcatgcaattaatgccaggcgggcccgacttatgtgagaacacattgcactcaaggtagtagatatgactttctcgcatatgtggcttagttacaattttaaagtttatatcttacttaaatcttacgaataagttgatgtacatatgtgcaggattcaaagattaatctattcaaatttcaaatttttattcaaaaaattaaaaatttccagcaaatggtagcacagctttccaaggaacaccacaagaatctatttcattctttgaaaaatgtggacatcgagtgccagatgagtacaatcccagcgagtggataatttacaagttggcagtgcaacctggacaagagaaacaatcaaatgatcgaattcagaaaattgtcgagcaatacgaagatagtgatcatcagaagcgagtgatggaacagttgtctgatgtttcagagaagatacctccgcctgaaatgcacagggctaatgtgttcacgcagattttcgcgctttccaccaggttagtattgatgcttaaaagtgtaatcttacttacaagatctacattgtattacatagcattctacatagtaaaattcacttacaaaattcctccaaaatgtattctttgttccagatgcggaattgatgtttggcgtgctccccaactgacattggcaaaagtgattcaaaagattctattcggactattcattggtcttttgtaccttcgggtcagtattctatattctccgccattttatcaaatcaatttcagacgccatacgatgcacgtggaatccataatattaatggagccctgttctttctggcaggagaatacatttactcaacagcatacggttatataaagttggaaatgacaattgataatatgcgtattttatttcagcaattatgttcttcttgaacaatgaatttccactggttgctcgagagtatcacgatggactctacaatctttggacgtaagttttttagttatactagggataattcattttaaaatttagatactactttgctcgttgtatctctcttattcctctcttctctactgatggtcttattcttctgtttatagtttactggttgattggacttaacacttctgttatgcaggtatagaattgaagcttgcagaaaaatcacatttctgtgtttgcaaggtcacctacataaaacgttgaatcccacagaaattttcagtacagttcatgaattgagaacatcccaatttatccttgtcagctataatttttcaggtcattgtcgcatcaatcatcactgtactcgcaagtcaagcagcctctgcttttggaatcgccatgtcatgcatcttcccaactgctcaggtcagtgacttctctcaaaaataattattcacttttttccagatgactgctgtaatggcaagcccacctctagttttgttccggcttttcggtggattatacggtaatactaacactttccctgccgcaattcgatggcttcagtggattagtatgtacaggtattggaattatagtttattatcaaaacattaaaagtttaaagatttgcattcgaaggtctagttgtcaatcagtggtctgaaattgacgatttccactcaaatgccaaaaataattggacaaattctacgacgaacgatgtgcttgattactttgcattctctgaatcggcaattccacttgatatcattggacttatactcattagtttggcattctatttgattggatttattgctttggttcatcgtatgaaaaaagctcgttaagattagagaacacaatatttgtgaaatgaagatgtagtattaaatgttttatttttgttcgatagccggctccgtccagagagtattctctaacataaatatgtaaaagtattctgttaatactgattgactccaaattattggcagaccatatttttttggaagtcaacatttctttgagttctgcagctggttcccagtattgaggatacgattatctgattacgcagctccgccacactgtcgtcaaaattcttaaaac