Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302E4   

TH:302E4RNAiTH:302E4
PCR_productTH:302E4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF57B9.1 Source_evidenceePCR609WS150 Sequence/Annotation Release
Overlaps_Gene F57B9.1 Source_evidenceePCR661WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598F57B9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII69624246963475
Overlaps_transcriptF57B9.1 Source_evidenceePCR661WS150 Sequence/Annotation Release
WB_DNA_textTH:302E41052gaatcaaagttaccaaccacgtcaccattcgaactttttgatatctggtttcgtaacgtcgcttcacaatctgacttaacattcgaagaaatcaatgcagtatccttatccaccgtcggaaagtgagcatattacattcaaaatggagaaaaaaacctagaaagtattaattcagagatcttcgtccatcatccagaatggttcttctgaaagcgtacacaccaactggcttctcgttttacacaaattatactagccgcaaaggaaatcaattggaagagaatccgaatgccgcgatgctcttttattggcctaaagtcaatcgtcaggtataattttcaactgctgaaaatttgaaatcgagattatttaatttcagattcgagttgaaggtgttgttgagaagcttccagatgagatggccgtcgcttattggaattctagaccagtagcaagtcgaatcggatcaaaatcaagtgatcaatcaaaagtggttcccgatagagaattcttagaatccaaaaaagttgcactgacagagttatctgtacgggaaggagctcaagcaatcacgaaaccagaatcctggggtggatatcatttgattcctcgatattttgaattctggcaaggacaatcggatcgtcttcacgatagaatagtattcgaaagagatgttgatgtgtggcttctcaagaggctttcaccataattccattcacttctatagttaaagttcgtgtagataaaaattaaaaatattttccttgagaaatacgtcgtatttatttatgaattagaccataaaattttttcttaccaacggaattacttcaacaaaaaattacaagttaaaatgaatcaaattaatcacaatgtatcctgttatattcttaatcacttgtgaattagttctcgaattataatttaaagaatatgtatttgattctttaatgatcattttcatttccgagttatttcaaatcaaaatgtcaattgaaaatttcaatttgaaataatagcccatagaaaggtaggctatcattttccga