Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302E9   

TH:302E9RNAiTH:302E9
PCR_productTH:302E9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06G4.2d Source_evidenceePCR1381WS150 Sequence/Annotation Release
Overlaps_Gene C06G4.2 Source_evidenceePCR1381WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII79830527985070
Overlaps_transcript (6)
WB_DNA_textTH:302E92019gtgattatgggacttggtggaaaagataattctcttggaaatatcggaaaagttattctggacaatattatttctggaaagttccgtagggatgttgatccattcgttcgtccaggaccagatccagatagaggaggtggtggaagtggtccaagccctatttcaccaagaccaactaccgaaccacaagacttctatgagctcagagatcaatgtcttgaggtgagtgttcaaaacatatcatttttaaaataataaattcagagcaaacgactattcgaggatccacaattcttggccaatgatagttcgttattcttctcgaaacgtccaccaaaacgtgtagaatggcttcgtcctggagaaatcacaagagagccacaactgattacagagggtcactcgagatttgatgttattcaggttagctcttggattattttcagaatttttaatatttgaaatgtactattaaaattatatattctttcagggagaactcggagattgttggctcttggctgctgcagccaatttaactctcaaggatgagctcttctatcgtgtggttccaccagatcaatctttcactgaaaactacgctggaatcttccatttccaattctggcagtacggaaaatgggtggatgttgttattgacgacagattaccaacgagtaacggcgagcttctctatatgcattctgctagtaataatgagttctggagtgcacttttagagaaggcatatgcaaagtaagttcggacttttgaccgacatttatgaaggaataaactagttaattaattttcaagattgttcggatcatacgaggctctcaagggaggtaccacatctgaagcacttgaggacatgactggaggactcaccgagtttatcgacctcaaaaacccaccaagaaacttgatgcaaatgatgatgagagggtagggattaaagtctaatttacattattatccaaaaacgagttgtgccaaactacagtacccggtctcgacgcgacaatttttgttaattatgaatgtctgtgcgcctttaatgagtactgtagtttcaaactttcgttgatgccgaattttcattgattttgcatagttttttgttagaaacagaaataaaacaattaagaacacacaaactatgaaaaatcgataaaaaattccacaaaaataaaatcttgaaagtaaagtactctttaaaagtgatcccctatttatattcgacaaaaagttgtcgtgtcgagaccgattaccgtattttttgcgcaaattttagcgtccatgtattaacaaaatttcagattcgagatgggatccctattcggttgctccatcgaagccgatccaaatgtttgggaagcaaaaatgtcgaatggtttagtgaaaggacacgcctattcaattaccggatgccgaattgttgacggaccaaatggacaaacttgcattcttcgaatccgtaatccatggggaaatgaacaggaatggaatggaccatggtcagacaattcacgcgaatggcgaagtgttccagattctgtaaaacaagatatgggactgaaattcgatcatgatggagagttttggatgtcatttgatgattttatgaggaatttcgagaaaatggaaatttgcaatcttggaccagatgttatggatgaagtctatcaaatgactggtgtcaaggccgctggaatggtttgggctgcaaatactcatgatggtgcatgggttagaaatcaaacagctggaggatgcaggaattacatcagtaagtaaatattcatctacaaatattttcaattttcaattcagacactttcgccaacaatccacaattccgagttcaacttaccgattcggatcctgatgatgatgatgaactctgcactgtaatattcgccgttttgcaaaaatacaggtagcgccaccagatagggaaatcatttttatttttccaatttttaagacgtaatctgaaacaagatggacttgaca