Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302F7   

TH:302F7RNAiTH:302F7
PCR_productTH:302F7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH14A12.2a Source_evidenceePCR1119WS150 Sequence/Annotation Release
Overlaps_Gene H14A12.2 Source_evidenceePCR1174WS150 Sequence/Annotation Release
Chunk_score Abs_score1104
Max_abs_score1104H14A12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII74661447467442
Overlaps_transcript (6)
WB_DNA_textTH:302F71299gttacatggcagactggttcaggaactcagtccaacatgaatgtcaatgaggttatctcgaatcggtaaaaactaaaaaaaattgtttaaagattttattgaattcattgcagtgctatcgagatcctcggaggagagctcggatcgaagaagccagttcatccaaatgatcatgtgaatatgtcccaatcatcaaatgacacattcccaactgctatgcacattgccgtcggacgtgaagtcaactctcgtcttcttccagctctcaagaagcttcgcactgcccttcacaacaaggctgaagagttcaaagatatcatcaagattggacgtactcacacccaagatgctgttccactcactcttggacaagagttctcagcttacgtcacacagcttgataactctattgctcgtgttgaatcgactcttccacgactttatcaattggctgccggtggaaccgctgttggaactggactcaacacgcgcaagggattcgctgagaaggttgccgccactgtttctgaacttaccggattgccattcgttaccgctccaaacaaatttgaagccctcgccgcccatgatgctctcgttgaggttcacggagccctgaacacagtcgcagtttccttcatgaagattggaaacgatatcagatttttgggatctggaccaagatgcggactcggagagttatcactcccagaaaacgaaccaggaagctccatcatgccaggaaaggtcaacccaactcaatgtgaagccatcacaatggttgccgctcaagttatgggaaatcaagttgcagtcagtgtaggaggatctaatggacatttcgagttgaatgttttcaagccacttatcgttcgtaatgttcttcaatcaacacgtcttcttgctgacagcgctgtgagcttcactgatcattgtgtcgacggaatcgttgctaacaaagacaatattgccaaggtttgttagtaaatttagcggaaatttatagacctgattaaagtataagtagatgataaatagatttttcatttcagattatgcgtgaatcacttatgcttgtcactgctctcaacccacacattggctacgacaacgccgccaagattgctaagactgctcacaagaacggcaccacccttgtccaggaagccgtgaagctgggaatccttaccgaggagcagttcgctcaatgggtcaagccagaaaacatgctcggacctaagtaaagtgttgaagcatcaatatttagtaggcacatcttcgtttagtcaatcaatgtcc