Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302G7   

TH:302G7RNAiTH:302G7
PCR_productTH:302G7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC07H6.4 Source_evidenceePCR1823WS150 Sequence/Annotation Release
Overlaps_Gene C07H6.4 Source_evidenceePCR1823WS150 Sequence/Annotation Release
Chunk_score Abs_score1760
Max_abs_score1760C07H6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII75006297502755
Overlaps_transcriptC07H6.4 Source_evidenceePCR1823WS150 Sequence/Annotation Release
WB_DNA_textTH:302G72127tgaaaattttgtatccgagaagcgaagaagagcgaagacggccgcatatttgcgcgtttgtagcatttatgtctcgtgccgatgtggatagatttatggctgaagttcgtgtaatcatcgttcggaatgagccaattcgtttcgcttttgctcgtcctgtccagattcctgctattccttactacattccacccgtacttcatgcccttcaacatcccgatccaacttcaaatttacccttcaatgcacaaccggattgtgctgatgccaaaaagtttctagaaaagtacaatacatttccaccgatgcatgcattgccaacaaaaggacaatatgggtatgaggatttcacagaactgatacggaattcacaaattagagttgttgtccccccggacaggaagctggtcagagtaatggatcgaatggccgtttacgttgtaaccgaaggacctcagtttgaagctatgatatgtgcagaagagtttcaaaatccaatgttccaatttctttgggataataccagtgctcttcacgtttactatcgatggagaatttattcgttgcttcaaggagacactattgaagaatggcggcgcactccatttcgaatgttcgaaaatgggtcatggtggattccaccgtatcccatcaatgagttaagagatgcaatgccaaaagaactgtatcatatgaattgccttagaacctatccggataaatggatgaaagtacgtgacggaggtcaacgaagaggaggtgagagctcaaagaatcgtcggaactcggatgctgaaaaggaagaacgaaaaatgcgcagggaagaggaaaaagaacggaaacgaagagagaagaatgagaaaaagaggaataatcgaatgtctgataaacgacgtgataaactggagacattgattcgagagctgacccctgagaagacgtcgatagccgctacgatggtttggtgtatacaaaatgcaaaatatgcagctgagatttgcgagtgtgtatatgatagtctgaccattgaggatatcccactttataagaaaatttcgaggtaattgacttttcacttttaaaaaagtctgcaaaaacacacatgtaattcgtttaattcgggattatattttttatttcaaaattaactccaaaaatatgaagctaagattttaattgagcgtttatctgctcaacttcaagttaacttccatagttgtgctgatataatatttaattaattcaggctctacctcatcaacgacattctatcgaattgtgtacaacgtaatgttcgggacgtttttctctatcgttctcacttcgaagctcttctggagaaaattttcgttgctgtcgggaaagcatatcgggcgataccgtctcgcatcaaacaagagcaattcaagcagcgcgtgatgtgtgttttccgaaattttgaggaaatggctgtatatcctacagataaactgattcataatcaaaatgtattcctgggactcattgaaatcggaaaagaaaaatcggaagaacgggataaccaaaaactggaagaagaagaagacgaagaagacttagatggagtacctctcgaagaagaaaaatcagttcaaaatatgaacgagtctctttacgatgatgatggcatcgacggtataccattacacgaagaagtaaaaccatcaacgtctacttattcaactgcaagtaaattcaaacctgttgaggttagttcaagaatcacaccgtaattattgatgactttttacattaagttccattttagtttaattctaagaaatgctactaataatttttctgctgttactactcaattaatttcagtctcgaaaacgtgatggctcccctatattttcttcaaaatgggaccacgacggccgaaagtcgaatgaagaagaggatgaagacatcgatggagtcatgattacagacgacacgacttcagagaatctacaacgagatagtctttctccaggagaaatcaaggacaaagaatcttcatttaccgtgctcacaccttctgatgaaaaacgaagaaagttgatacgagacgttgaagttcgtgccatcgccatgctggatgatttagaagctgacagagatcct