Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302h6   

TH:302h6RNAiTH:302h6
PCR_productTH:302h6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08F8.2 Source_evidenceePCR746WS150 Sequence/Annotation Release
Overlaps_Gene F08F8.2 Source_evidenceePCR746WS150 Sequence/Annotation Release
Chunk_score Abs_score704
Max_abs_score704F08F8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII73606627361589
Overlaps_transcriptF08F8.2 Source_evidenceePCR746WS150 Sequence/Annotation Release
WB_DNA_textTH:302h6928gagtttcagtcgtgcagtagatttgctaaactaaagtctatcgatattacaattgacggaaatctcgcttatcttcgtttcgatgctcacactggcgatgcaatgggaatgaatatgatctcaaagtgagtattaattagcgaaaatttcaatcacaaaacgcaggaaagaaggaaaaccatttttatattattatctctgatgaattataaacatttaaaacaaaaaaaacgtcagaaacaaaaggataaataaaaaaaacctttcaaaaattgattcatctattttcagaagctgtgactctacaatgagattcctaatggaaaatttccctgaaatgaccgttctagctttgagtggaaatctctgtgtggacaaaaaagctgccgcaaagaattggacggaaggacgtggaagatctgttgttgcagaatgtctaattccaagagaagtcgtcacaaaaacccttcgaacaactcccgaacaacttgcttatctgacaaccacgaaattacatataggatcttctcgtgccggagcagtcggaggatcgaatgcacacgctgcaaatattgtcgcggctattttcattgcaacaggacaagatgctgctcaagtagtctcttcatccatgtgctcgacaagaatggaagttactgctgataagaatttgtatgtgtcatgtactttgccatgtgttgaagtaggaactgtcggtggaggaactattcttgcaccacaaagagcatgccttgaaagtcttggatgtgctgggccaaataaggagcaacctggacaaaatgcggaacgtcttgccgaagttattgcggccactgtgttagctggagaattatctttgatggcggctctgacaacgaatgagttggtgtcaagtcatatgaaactgaataggtcagtcttgggaatt