Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:303F4   

TH:303F4RNAiTH:303F4
PCR_productTH:303F4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF10F2.9 Source_evidenceePCR838WS150 Sequence/Annotation Release
Overlaps_Gene F10F2.9 Source_evidenceePCR838WS150 Sequence/Annotation Release
Chunk_score Abs_score817
Max_abs_score817F10F2.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII46437544644799
Overlaps_transcriptF10F2.9 Source_evidenceePCR838WS150 Sequence/Annotation Release
WB_DNA_textTH:303F41046ttccgcattttctgttgtacatatgtatatgaaaagttataaaaaataaaagaatgtatgcaatgaattcccaacagtgttgtaaagagaagttatgttttagatgtaacaataatagtatgaatatatgaatatgaataataatatgaatttattgcaataagttaatcaataatataagttaaaacaacagaaacccaggaaatctttacatcttccgatatgtatccatactcaataactcggcaatcttcttctcaacttcaggtgttttagtcgttgaatcttcagctacagatggatctttcatcttcatattgtaccaatctccataatcttcatctccattaccattattatttccattgttgccactgtttccattattccagttatcaccaccaccgccatttcctccattattggattcccaattgtttccatcatttccattattattattattgctaccccatcctcctccgttgttactgtatcctccagttcctccattattattattattattattattgttattattgctactagaagatccccatccgtcgtttctattgttattgctaccgtatccattcttactgtatcctcctccaaagttatcattgtcattatcctgatttccatttccattccatttgttgctactgccatagttatcattgtctccccagtttccacctccagagcctccagatcctccagttccaccatttccccatgatcctccagaattgccattattgcttccccagttatcattatcagtatttcctcctccagaacctccatttgatcctgatccaccattagatccaccccaattgttgctcaactcagatccataattatctcctccattattgttacttccccattgatcaccaccttcatttcctccacctcgatttcttccataactatttccacttggcttccatgatccttcatttccataattagaatctccatcatttcctccatttgaaccacttcccgaggatccaccccaattatcagagttt