Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:303H10   

TH:303H10RNAiTH:303H10
PCR_productTH:303H10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F48E8.7a Source_evidenceePCR1266WS150 Sequence/Annotation Release
F48E8.7b Source_evidenceePCR1257WS150 Sequence/Annotation Release
Overlaps_Gene F48E8.6 Source_evidenceePCR21WS150 Sequence/Annotation Release
F48E8.7 Source_evidenceePCR1459WS150 Sequence/Annotation Release
Chunk_score Abs_score1312
Max_abs_score1312F48E8.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII54464315448480
Overlaps_transcript F48E8.7a Source_evidenceePCR1459WS150 Sequence/Annotation Release
F48E8.6 Source_evidenceePCR21WS150 Sequence/Annotation Release
F48E8.7b Source_evidenceePCR1409WS150 Sequence/Annotation Release
WB_DNA_textTH:303H102050acttttggtgtcgaatgaaaatgcattattcaatattactagcgaaacttttatttgacaagttttgggtgttaactgtcacgtaactcgttaagaaaattagaaactagagaaatataggacaattgagaagtgcagttaaaataatatgtattgttatctattcgatatccatcattgtctgtccccagatcatattcgactcgcattggtagctgaccggtttggcggtgaagttgaagtactgacggttgaccttcagattggagcacatttcgaggaaaagctccatgttcgtgtcagagacgcagccatgaacgttgagataaacgagcgaaggcttactgttgaagtgtctggaaatgttttgtttaaataaattaaactaattttcaaataaactcacacaaccatattagggtccaatccgtagcatcgattgagagaaattgtcgtaagtctcgggaatttgttcagaatcactgcgaggcctggatcactaatctcgacgttatccgacaagtcgaggtcggtgacgtagttggattttgcggcgagaatctcaatatctggaattttttacagaaaattagaagattctgacaacagagccgctcacgtttattgttgatgccgaagtttcgaactgttcccgagagattcaactttttgagcttctcgccaatggaatgaatgattacggtcacaattggctgtgttaatccacaccacgccagattcagttgttgcaggctgaaaaaaatattacgaaggtgcacgggaacaagaaatatgttacagaaattatttaaagatacacgtggcaagaacactttcaggaaagttttaaaaaatccctcactctttgcaatttctgaagatcaaactggctccatttgccgtgattccgttggtcatcgagatgtcgagctcgcggagcccgcgattctctgcaatgcatattgccacgtggtcatccaattgatttccttcaattgacaagcatttgagcttctggcatggtttcaacataatctgcatttggcgggcagtgagattagtgcgagagagatcgagaagctccaagcgggaggtgctcagcagtgcaacttcgacgagccgttcatcggcacgaaggattcgatcggcctggaaacagttagttttataggaaataaaataaaattctcactttagctcctgccagacgaagaactttgatttttcgttgtgacaacgcaatcagtgaaatttcggaaataggacgatcctgggcgtcggtgataatccaatttctcgatttgtgtccgattccgtaaaaacgatgacagacgagcatcgccgagagaagatccttctttttcaaattggaaaagatttgttcagtgatctcatcgggaatactgtactttttgaacggattctgaatactgcgtgcgtcttttcgcttgatcggagcgatttcatcttctacgagatttttgcaattcagatttatcgactttagcttttcggagctgaaatgtcgtaaaattaagaaaattaagagataattgcagcttactttccggaaactgaaagcctgaggcttttctttggatagaggttgtagcatggaaagatggagatggtctcatctgagaatactttgaaaaagtcaatcatatttgaattttgacacacaattacctgtctccacgcaatgctcattttcagagggtccgttatcttctagagttgatggaagtcttcctatgacacgagacattttgtttgagtagatatgaggtgtagtatttaggtggtaaataagggaaaaagcactttctgcttgaaataaattcaaaacagggctgatttgaataaatatgaactcgcgggcgcggtaatcttttttaggttggcgcgagtttttgcaatgcaaacgcgctccaccgcaaatctgaattttcgaacatttttcgccaatttttatccttatttttttattttttgcaatatttcgctatttttatttgtttctcccaccaaaagcgcacatttttaaatc