Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304C8   

TH:304C8RNAiTH:304C8
PCR_productTH:304C8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05D11.8 Source_evidenceePCR1533WS150 Sequence/Annotation Release
Overlaps_Gene C05D11.8 Source_evidenceePCR1533WS150 Sequence/Annotation Release
Chunk_score Abs_score1470
Max_abs_score1470C05D11.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64252176427311
Overlaps_transcriptC05D11.8 Source_evidenceePCR1533WS150 Sequence/Annotation Release
WB_DNA_textTH:304C82095tgttccggagtattgttcatgttttttttttgaaaaaaaaagtaaaaaagcggaaaattttgtgaaactgtcgatgtttaacatttaaacattaattttataattttttccgaaaattcacactcgaattttttggagggggattgaaaaattcaattattatttttttggtacttttttaaaaaattttttaacaaccatgatcgaaataaacaatttttcatctaaatttgaattttgttgttttgaaaattacttgtttactgatttttcttaaattggaacaatgatagttttcgtcgtctttcgattttctttaaaaaataccaaccacgaaaattctgagcatttctctttttttctttttctaaaacttatagaaattcttaccacattgaatgttgcatcatcatccgactctgctggcagcacaaaacttccagcaactactccatcatatttccacttccaacttcgacactgttctgatcttgcatccattcgaatccttgttgaatacatatacgaactcaataatgcatgtgaagccgcctaaaacacttgaagggggttacatagtcaattcagaaagaaagtagagtacctctcgatattcaagcatacaaattggaatgcagttcagataggtttgcgaaagttctccacctcttgatgctttgtatacaactgataattgttttttggttgccgagtgattagtgagaagtggacggaacacaagagccaacattacatcttcacatgccaatttcaaaaatgagtcaattagggatagtgatgtcacggaagtctgaaaatttatatgtattttttaaagttaatatgatacgagacacttactttatctcctcctttcacataagaaatgactatttcgtaaaacaatgttccattatcatcccgttccgtcagaatcatttgtacaattgacctaacgagtacaggttcgacgatagtttctaggcacatttgtaaatataccatactcgctccaatatattctcgatcgttttgtaggaatgctggttttatcacattcgttaaaaatccagtgtagaaaaaggatgcaatatttccaacaacttctgaatgagcagtttgagcaattgcattacagaagagtagtgccgaatgataatcagcaaggaaatctctatattcatcctctacgagacgctctcctccatctccaagtattattcttggtaattgggagaaacacgctgataaacctgtggtgagtacttgacagaaagatgttcgctctgtcacatattcagcaatacttttgtcttctgctgacactgaaaggatcagaagtacagcatctctagcaagttgtccagtatctccagcagaatataaaaatggaattagttcggtgaatacgacaaattgattggagtggaagaagaaatgtaaaagtgttctgtcttcaactaactttgtacaaatctgattcaaaagcaaaacgaacatcttttcagcttctgaagtctttttattttcagatttagatactctccagtagatatctgctcgttgaaaccattcacatagccgaaatagaggatttaagattggcttgtgaaccagaagacagtgattttgagaatgcgaatctgaaactatcatttcgaatattcgaatgatagccagttggcatatcgatttcaaagaatcagtcagttgaatcgaccaatccagcactcgttctagaatttgttcagtaaagaatttatccagaatcggtccgataattggttcaggttgtgagttggcttctaacatgagtaatgtacacatatttgtcatattctccaaaagtgacattagctcatcataaacaactttgtgctctggatcactgagcttccgttcgagaatgttgctaacaacgctccattttgtttcaaatagttgttcccatactgtcggatctgaagcgtacgctgaagaccatcgagctcgggagacagatgtagctgaaaaattcaggtccattatcaagttataaaaagttcaacttacgagtacccgaataaagttcatctctaacccaatcacttgatga