Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304E5   

TH:304E5RNAiTH:304E5
PCR_productTH:304E5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12A2.7 Source_evidenceePCR717WS150 Sequence/Annotation Release
Overlaps_Gene T12A2.7 Source_evidenceePCR827WS150 Sequence/Annotation Release
Chunk_score Abs_score722
Max_abs_score722T12A2.7
Specificity_index0.54
Rel_score1
Map_statusBest_ePCRIII62446686245783
T12A2.8 Source_evidenceePCR719WS150 Sequence/Annotation Release
Chunk_score Abs_score614
Specificity_index0.46
Rel_score0.85
Map_statusTop85_percentile_ePCRIII62446686245783
Overlaps_transcript T12A2.8.1 Source_evidenceePCR719WS150 Sequence/Annotation Release
T12A2.7 Source_evidenceePCR827WS150 Sequence/Annotation Release
WB_DNA_textTH:304E51116aaaaataataaggggcaataacagggacaagtggagaaagtgaaaagagtatcgatttgaagtgtgtataaaacattttttaaatagagccaaatccaaaatcagttctcctgatcctctttgtcatctaactttgtcggatccaatttgagcgccttgatttgttttctgttatcactgtcgatttgtcgattttccatttccattctgaaaagttgaataagtaattaaaaattagaacaaagtattttgtcttacctataattattggtaaccatgctgacccatgactgttccaattgttttactttttctcctgccttcaactgtgccatttttcgattcgcatgaacttccatgacggcttctttcgtttttcggagttctttctcggcatgtgttagaagatcttccataactttgtttctctgaagataactctcagcagcgtattcatccataagttccagattgatctggcgcatcagaagatgctcattttgagcttttgcattgcgaagaacctgaaaacgaatattatgatgtattttttaattagtagttgcctttattgattcattgaaatttatctactaaccttcgcccaaagttttctatcaactcccttaacagcagatggagcaggaagttcacaacgactcatatccaactttcccatctcttctttctttttcattcgatccatttctttgagcatacactttgtgagaaaagcatcatagtcgggcactggaagatgtgtcaagtaatttttcgttggacggaatgtctgaaaacattaaattttccatatatggcggaattggcagaagtaatgaaccttgcactcatgctccacaagtttcattgcgagctgtcgatccgcctcgttgtactctgtgtcaaggtaaggaagagcatcgacaagaacctgaaaatagtcattttacactgaaactagtagtttaaactacttaaaaacttggataggtggataaaattgattttagaatctcaaaaatatttacctgatcatcctgcaactgactagaaccacttccaccggtaagtgctaacggtttggagctcatcacgtgaacctgaaattgttctgtc