Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304F11_13   

TH:304F11_13RNAiTH:304F11_13
PCR_productTH:304F11_13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y73B3A.13 Chunk_score Abs_score752
Max_abs_score752Y73B3A.13
Specificity_index0.573
Rel_score1
F28F8.7 Chunk_score Abs_score560
Specificity_index0.427
Rel_score0.745
Overlaps_pseudogene Y105C5A.7 Source_evidenceePCR1327WS150 Sequence/Annotation Release
Map_statusUnique_ePCRIV1559883815600164
WB_DNA_textTH:304F11_131327actaggcagtaatggtaatttcaatatatcaacttttaaaaaaaccattttaccgccgtgaacaagttccaatttcagaaatgctccgacgcctacatatttcgaagcctcagtttgccaaaaaagcgttcttctggttggaacacggcgatgaggagaacattgcaccgaatattctcgaaaccgaaggcgaatcgagtggcgaggaaaatgttgacaaaacactcatcgcaaaaaaatccattcggaaaattacaccggctcgatcattcgagaaaaagaagaatccctcgcagcctttgaacatcaaaaaggtgaaaaaggtcaggaagaattcctcggattccgtttgctcgagtaaaaagagcggagaacagggtaagaagactaggttcttaacgtttcaatcaaataaattattttcagcttcagtggaccaggttccgccgcccctgcaacgagctctgtgtacgaaaagccgttcttcgaaaaattcggaaaattttctatatctcgagaatgcagtaggacgtgaacaccaagcccatgtcggaccattcaaaaaactccgagacgcgatgaggaggaggatcgagatgagagaatgtggtgtccgcctgatgatgatcaaaacttggactacgacctgctcaaaaacgcgtactggagagcaatttggcgccaattcgaaaatcatattccgatggaggttgcacttcaatggttgatgatcaacgactattcaattgagaagagccttgattccattgatcaagtacttccagatcttccacgtgctttccagccaatacgtgttgcgcaaattgagcggttcaaagatgctctcaagaagatgaaaaaagggccaattttgcgagaaattcagaagaattgtgtaagttgaagctgttagagggcaaaagcgttgtaagcaaatttttttaaattttttctgcaaaaaaatgcacggaaaatcgaggaaaaatttaattttcatctcaacattttttttagaaaattaacaataaagattaatttttcatactgttttgtttagttgatgagcaaaaacataagaaaacatataattttattttgaaaataataaaaaaatgaccaaaaatacaacgttatttttcgaaaaatttcgatttttgggagaatagtctgaattttttcaaataaaatgcttccagatgcccaactacaacctcgacgagatccatcacttctgccacgcattccaacatcacatcatggaaaaaaccagcaaatcttgccactgcaacgagccgctctgtgaggacttggagtttcaacctcgatg