Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304F12   

TH:304F12RNAiTH:304F12
PCR_productTH:304F12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK418.5 Source_evidenceePCR601WS150 Sequence/Annotation Release
Overlaps_Gene ZK418.5 Source_evidenceePCR601WS150 Sequence/Annotation Release
Chunk_score Abs_score498
Max_abs_score498ZK418.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII70727637073672
Overlaps_transcriptZK418.5 Source_evidenceePCR601WS150 Sequence/Annotation Release
WB_DNA_textTH:304F12910tcgttctttcttgtggacgctgtccggtttgccgaatagacaacgacggtgagaattgctgttgcgatggagtaggcaaagcggaatgccaagagagaccatccgtagagagagaatgtgtgttgaacggttctgaaataaaaaaaaatttacattttttgactagtaaaaccaatacttactgataaacgaatgttgagaagacacacatcgcaaggatcggtgacaccaagaacttgtttggagtgcgggtgatcatccatgtaaggcaggcgagagacacaataaccaatagatcagctgaggaatcaagagatgtctgaaaatataatattatctttttttcagaaaaaaggaagatttgatcacctgaacccaacgccatgtgaaagcggttccacgagctccaacccataaaagaacaagacgatgagcaacagaatgagcgaatccccagccaagaccaccgacaacgaatcgaacttctccttttccggctaagaagttggtcatcagaaggtgaagcccaatgacatcgatgatgtcagcactgctttttaggaattcctgcaatgattctgagattggcaatgaaaaccaaaatcaataagtttgaagtgtccgaaggattatgtccggcgaggatgggtttatggtaaatttcacttaaaacttgaattaaaatgattttcattgaaacgttatttatagctccaattttgaatagaaaaattaattacataccggcacaatactgaatccttcactgtcgagggctgggaaaaatgtggcaatgataagcagtttggcgagttgtgtcagcaaatatccaccactagcagttgcacatttccagatggaactgtattcgttaattcctataaaaatagtggtgtttcattgacttccc