Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304F7   

TH:304F7RNAiTH:304F7
PCR_productTH:304F7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C56G2.7 Source_evidenceePCR829WS150 Sequence/Annotation Release
C56G2.9 Source_evidenceePCR579WS150 Sequence/Annotation Release
Overlaps_Gene C56G2.7 Source_evidenceePCR831WS150 Sequence/Annotation Release
Chunk_score Abs_score810
Max_abs_score810C56G2.7
Specificity_index0.621
Rel_score1
Map_statusBest_ePCRIII63410356343265
C56G2.9 Source_evidenceePCR579WS150 Sequence/Annotation Release
Chunk_score Abs_score495
Specificity_index0.379
Rel_score0.611
Map_statusTop50_percentile_ePCRIII63410356343265
Overlaps_transcript C56G2.7 Source_evidenceePCR831WS150 Sequence/Annotation Release
C56G2.9 Source_evidenceePCR579WS150 Sequence/Annotation Release
WB_DNA_textTH:304F72231catcagaagttggaagatgcggtgcgagctcttcagcgtggttacgagcaacttcagcaaccgtttcattcgacagagcagttgccagagagactgccacctctttcttttgtgagcgtcccaagttgttgaagatttgttgaatcgccgggttattcaaggaaagtggatttgaagatccttcctcagctgcattcgtcgaaggctcgcagtctgcttctgacgatgcgtcctctcctcgaggcacggaagaaattggaagagtgtcagagtttccgccttgcagagattgaatcaatgacatcaattgcccttgatcgatgcctccaaggggagcattcatgtctgagctagagataagtgatcctccagcagactgacgatcagtgtttgcgttagaaccagccgatcgggaagcagctggacgagatgtcggcggcttgttcagagcgtcagtgaccttcttcacaagatccttgtcaacgtctggtgttgaatcttgaatccaaaaaagcttcatatctccagatttgaacttgagcatatacactttgccatcagggcatccaggaacagctttgaattcagcgtcatcggggaagattatgaggtcatcaacaactgcgccagtttcacgatccttccagcaaaagtggatgagcatgtcgttactttgcttaatgaataccaatccctttttgggttcagcaacaacttttctcatagtatctccggatccagcttcaaggcgagagcgtccagctttgaattcgacaatatggccagaagaggaagcgaccgagcgagtattactgaacatagcagccatctctgaaataaataaatgaatgtttgataaggaagctgaaaataccaagatgaaaaaatagagaacaaacttgcaaaattacgaggaatgaatatcacaaataaactgaagtattgataattgatttggaaagtaacatgtcggacagaaacaaattatttcccgtcaaaaaaaattaaattcaaataactagtaaaaatataatgtcttttttaatatttaaaagataactcgaattgaagaaacaattgttaacaatattgttccaaatttggctaaaaaaggatgacttttctcgtggtgcatttgctcgtggtgttcagtgcttgcgtacaaaacgctgtttccgaatgcacaccgtacatgcgatattttgtcacgttttgtgttctatttttctgtatttaacttgtcctccgctcgttttaagacgaatttgcctcattatttttttacccaatatcttaaaaatcaaaccactttattcaatacattattttgacaaaatcggtctctgcaaaatttgagaatgccaattaccgattagtattagtatttttaaaacaaattcactgggtatacacgatgagtattaaaacatattagtttagttgtcaatatcatccagttcaaagctgtttttgctctttttcttcatctcctgagcctccttcatctgagagaatggcccacttgccgaaccaagtgaggtcttgctttcctttgatttcaatgttttcgttttacccgtcttcatagtggtcgagtcggttgtgatgtcaacttaaaaagtaattttagatgtctacgtgacttttttttaaagatctaccgatgttgcgcatcatagttgctgcctcaaagatcccgagaccaacattttggggacttcctagtcctggagattccaaactattgctccgctgcgaggaaatcgtttccttctctttctccacaccaccctttcctacattcagcgacatcgttgacggtttttggtcgcttttcttgatagattttcttttctaaaatttcagataatcaactattttttcaacaaattaaaaattgacttaccgggttcttggtctccatctccgacatgtactctgatagattgatgattttatgaacacttttccttcggtttaactcacttttgtcgttttttgcctgatccgatagtttcagatcacgagtttttgcatccaggtcatcgaagatcaattctccattcttctcggttctctggaacatttttttctgattgaaattcgtaaccttgtcgggtaacggttcgtttttgaatacagataagaacaaacctttgcttcttcctgcttcttcttatgctcgctgaacatggtgttagccgttagatggtgtagtttgtagcaagtgg