Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304H2   

TH:304H2RNAiTH:304H2
PCR_productTH:304H2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T04C9.6 Source_evidenceePCR1212WS150 Sequence/Annotation Release
Chunk_score Abs_score1107
Max_abs_score1107T04C9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII59765905978841
Overlaps_transcript T04C9.6.1 Source_evidenceePCR1212WS150 Sequence/Annotation Release
T04C9.6.2 Source_evidenceePCR1199WS150 Sequence/Annotation Release
T04C9.6.3 Source_evidenceePCR1149WS150 Sequence/Annotation Release
WB_DNA_textTH:304H22252atgaaaagagtgaccagattagaagactctagcacttttcagcaggagccggagtttttgggtttttcgagaaaatacgaaatttttgtatcattttataaagtgcgattagaaattatctgaaaatgttataagaaagaaaatcatttcattatatgaaaaatgactgaaaacaacaaaataaaggctgcaaatgtaaatacattatcaaaagtctgtgacaattctccgttgatgttgcattgggggaacaatacgagatggcggagcacatccattttgtgaatattttcgtggctcctggaaagtttatggagtatttgaaaacatactgtccatcaataaatttaacttacttcaaattgagtctgcattcgaacagctggttgtggaggttgtgagctcttccgctgctccgatgcactgctcattctgggaattttcgaatttgactgatgagctggaagtggtggcggatgtgagaatgatgtggatgttgagacaactggacgtggaatatatgaagatggggcagcagaagatgatggagtatcgagatttccaattgttccaactgttattttagttacatgtgacagattatgagaggatgatgatgatgatgatgaaggtgttaaaggatccgaaataaatggattactgttgtttactggttttttgaggtctggagatgttggtaatggaacgttttgaattattgaatgtggagaagttggatctgattttgcatgggttcgctgttgatcattggctctttgttgctcaattatctggaaaaaagtttgtttgcatttttgagtttaagctaattcagaaattaaaaaatttttaagttttttaaaaaattgtatccgactttccaaaaatgataggttaaaccttttgaactgactagtgagcaaaatttaaaattgaacgttagatcgatgccaaatgtttcatgaatcgaaaaataaactctaaataattactccaatttttgttgaatttttagcgtgaaatgtacctgttgcctcatttcagctctctttgcatccctaatttgtgcatttgtcacatgactttgccgtggaccatatctctgactaggtcttctttcaaatgagcatgattgtcttcgtgataatcttgctccttccttatgaattgtttcatattctgtcctgcctctatacttaaatgtgcttcctaaccggaagaactgaattttgcgattcgcttggattgggcgagatttgaggcggaaaaatgcgtgttgctcgatggcacatttccagaaatgttttgccgctttttcagacgtcaagtgaaaaacgaacgtgtgcagctggatttggccattgttctgaaaaagttactatttttaaagttattttgcacatttttttcaattaataaattgtacaaaactgctactctaatcttcattaaacttttcattaaaaaaactcaccgattgatcagcatcctcctcgacaaccagtgtaattttcttatttttgaaatccaatttttgtagtttttcccataaaaagagtccaattttctgtggaccatcaaataccagcattccttgtggagttaaacccaatcgatatgtatttccatcttttccttctacaatatgcatatctactccgtacatttcaatccatcgtgccttattcaagtagttcaactccgcttgagccggagtttgtccactgaaaaatgttattttagtttttagattgagaagcatgaaattgaaaataaaaccaattaggtaatttttttctgtccgaaatgtttttatttgaaacttaggcaaatactgcaattttcaaataagtgtattttttgttctttaagattgaaattatcaaacatttgttatcaaatttaaaattgtatctatgtagttttgattctcaaatagtcaatttcctgattgaaatatttacgtctaaccaagtttctctcaactttcaggtgtcctctaatttgatccagcagaaaatcccgggtttcacactgattagaatattgatttctggcaaataccagaacaatataatgcatttcaaaaattgacattttcgggaaagtaatatcaaactctaaaaggttttccagtttttaaatttttagactatattttacatgtgctgtaaagttttctaacaatcttttttttaattttataacaaaaaaacttaccggcacgctttgtacctctccaatatctcgac