Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304b3   

TH:304b3RNAiTH:304b3
PCR_productTH:304b3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK328.5b Source_evidenceePCR1974WS150 Sequence/Annotation Release
Overlaps_Gene ZK328.5 Source_evidenceePCR1974WS150 Sequence/Annotation Release
Chunk_score Abs_score1890
Max_abs_score1890ZK328.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII60137616015953
Overlaps_transcriptZK328.5b Source_evidenceePCR1974WS150 Sequence/Annotation Release
WB_DNA_textTH:304b32193tcacggaagatcttaaacatttgccgatgtccgagaagctttgtccactctggaagtgtattcttatcagcacggtactcgaacaaaacacgtccaattgtttgaagagagagcctgaaattatataaatagttttaaaaaaaacttatgtcccaatagcttacttttgaagactgttcttgctgattgtaggagcatgtagacgagtttccagactttcaagcacgtcctgtaagagttcttcttccgcatcattttcgatcaaattgatcaatcggcaataatcagtgtagaccattccagtcgcaccccactcgggaatctgattttcgaaaggacgaaccatcgcgcatgctgctttgagagcgtcatgatctccagctacaactgcagttggtgcaatatcatccacaaataagcgacaaatttccagatagttctttgcagccacagccaattcgaaaagttgggtagaatcatcgactgactttgcaattgagaattgagcatcagcaatccattccgaaggaatatcgaactgttcggaaatagaatcaaacatatcattgtcggtgaaacgagcaatacggtcgaggagggaacgaactgctgttgatcttctggataaatatatttataaattgaaagattctaaaattcaactcactcttcatcatcatcaatgtgctgcaaaacaaacaatgcatattttgagagacttgatgcttccaattgagatgaatagtttctgtgaagtcttgtttccgaagtctttgacattgtacggtatccaaccgaatagagcaagctccatacgtgccattgaaggaaataatcgttgggattttctccagctgcacagtcaagtacaacttccactgagtgctgtgattcacatgccaatttgatgagttctccgggcagatctccacgattagaagcggcacggccagcattgacatctttctgataagcatcgtaagattcttctagaccagtccatgcacgaagataccagacatgcaaaccgagtgcttgaatccaattgagtccatcaagacagttgatcgaatgattctttccgtcttgatcccattcgtagtgtgatagtcctgacatcagaacatagcatttgagagtttccttcggaatcaaatgaagagtttcgcatttcttccagttgtcaagttgtgctttaaagcaatgaacagtagcttctgggcacacagcagaagtctgaagcatcgtagcaagctgtggctgattattatcaatcgcaatttgaaaagctttatcgatgtctccaagacagagttgattccaaacaccatttgaagatgtatccgcacttctatcgtctggaacagacttcactgcttctgttctaagccattctccaatttcttcaccacgctcgaaagaccatccttctcgacgttcatatgggaatagagcagatatcaacttccaaacagaaacatgtccatcatatccaccagcttgagcgacatcgatgtacttggcaaacatggatgaatatgagtcagaataagtgacgaagttagaagtgagcgaagatttaaccgagttggattgtgaagatggacccttgcgactggtttcagatacatgaacattcacatcaagcattgagattagcgtgttctgaaaattgattaaattaaaaatgggccatagaagagaacggtgtaaaaaagtacttagaaatccaattgacaaatagactgtaaatcacagaagggcttttataaagtcacaaatattacctcattcacgtccgatgttctatcaattgtcccaaagagtacttgattgtgtcggggttgagctgaccacacaagacatccagtttcactccatccgacatgtgaacttcttcccttcacaattcctatatcaatcagtttgctctttccatatccaatcattttagcagagtgtccaccaccgtggaaccgatgagctgggtcgttggccttcggcatgactttcagttcctggagattgcgaatgaatcgactgctttcgtattccaaatcagcgagaagttcaagtttcggcttcttttccggctgctgaccttcttcaataattgaatcatgaccactttcattgaattcggtggtcatatttccgatgcatgattcttctcgactatcatccaatgttcca