Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:305B10   

TH:305B10RNAiTH:305B10
PCR_productTH:305B10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06H7.8 Source_evidenceePCR1020WS150 Sequence/Annotation Release
Overlaps_Gene K06H7.8 Source_evidenceePCR1020WS150 Sequence/Annotation Release
Chunk_score Abs_score852
Max_abs_score852K06H7.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII80964648098052
Overlaps_transcriptK06H7.8 Source_evidenceePCR1020WS150 Sequence/Annotation Release
WB_DNA_textTH:305B101589tattcagcaatgaggagtgaataaaaattatactccattaacattacagtatcccatacagtgcactcctattcgattacatttatcctacaaaaaaagttttaaataaccgccgctagtattttttgagtagtaaaataaatctcataaatttttattcatttcaaatacaccaataaaatcaagttcagttctagaatccaagtgggttagtgttgaagtcatccacagtaaagaaagaagcttctgggagctctccagattcttttgttcctaaaaataatcaaaattaatttttgacaattcaagctgtgttacctttctttcccaatccaaacttgttcccttgagatgctggatttttcttcttctctggctcccaatgatatgggtcggaccatttataattggcacatttcatgacatcttcaagcaatttgaatagcttctcatagtctggacgatgatagaacagagtggaacgaacagttttcacaaagctcagcatttgaacggggctctttgcgaagagaacctcgtcgtggatttttcgcttcatttcaccgatttccacctgcaaatcatggaatttaacaaaagattttgtattttctaaccttatcatcaacatcatgccatgccaatcgacatctcatctccgccaaaatgtacaccaaagcccacaagtcatcaactcttccttgctcataacggtcatgcatcgccactgagcaataacgggcggttccacggaaatatgttttctcacgtggacgacgcatcttcaatccatcgtcttcgtcggcaatgtattgacgggccaatccgaaatcaagcacgagaaaatatctctcgtcagctgagcccttctgtaaaaaacttcattgatggttatacatttctagactcacacaacccattgccacgttggcaggcttcaaatcccgatgaagatatccaatctaaatgttaaaatttgtttgatatcattcaacttcacctacgtcatgaacctgtttgattccgaaaaggatacaaataccaattctaacttgagtggaaacattcagaaaaggtccgtgctttctgaaactcaattatttcaataatttttcacttttagacagcctacttaagaagtgaatcgagactctctccaagaagggtcataaccatatatgagtacctctccttcttcccactagccacacattttgcaacgtgctttttcgaaatgagctgggagagaatctgaataacaacgacctgagacccttaactataagctaaatcttacctggacttccattttgagaatgttaccagcatcttgagacttgaactcaactttcagtgcatagtgttgacccttctccgatgtgtcttcaactttgaagaccgagccacaaccaccttcacctagtttttgaacgaccttaagtactcttatagatcaactaaattttgacattttgattaatgccagttggcaggaccaactcacttactaaaccaccataatctacgcgcaaattcccgcaactcaccttgtatcttttcccgacaaccgctccaatttctagcgtctc