Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:305F5   

TH:305F5RNAiTH:305F5
PCR_productTH:305F5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR13A5.9 Source_evidenceePCR1199WS150 Sequence/Annotation Release
Overlaps_Gene R13A5.9 Source_evidenceePCR1199WS150 Sequence/Annotation Release
Chunk_score Abs_score1055
Max_abs_score1055R13A5.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII75761247578392
Overlaps_transcriptR13A5.9 Source_evidenceePCR1199WS150 Sequence/Annotation Release
WB_DNA_textTH:305F52269gtgataccctacttgaagagcatattgagcatgttgtttggcgtgtggtggagcaacaagcgaaatatacgatgatgcgcaagaccagacagtggcgaggcaagctcctgaaaacataataatttttaaataccttcgcctttacttgaagtttattagatcttttatcttaaacgttgaaattattcaaaaaagtgcaccagggtcttatatagcacgtggtgtcaggctgtctcattgcggtttgatctacgaaaaatgcggcaatatcgttccagaaaattgtgacgtccgcacgttcttaaccatgcgaaatcaaatgagctgtctgcgtctcttctcccgcatttaatgtagatcaaaccgaaatgagacaatctgactccacgcgtggatccggattccacgtgcatagcacgaggaccaaaattgggatttgatttgaaatttcatttctcatagtcagcaaacaatcaaaatgttaaaggttttttgttaatatgtcggaagttttgagacaaattccaagcttaattttttcatgtttttattggattttaatgtttcaggtcatcactaaaattttaaaacgtgtctaaaacttgataaatctaaaaattttctcaccctgcaagatctgaagtggaaggaccatccatggattatcaagaattgagagtgccatgaaacggaagaaattgacagccagacacaggtacatgacgcggacatgtccatactggaaattgtaaacgtcttgtttctcttctatacattatatgttcttgcgaagtgtgggttatttttaaaacccacattataactttgattctttgtatgtacgagagaaaccttcgagttaccgtacactcgagttacttttattctttacaattgtcatttttgcgaaaagtccccggaaaataattttgggccgaaaagcgaaaaaaaaacttaccttattaatcagtttgaaaacatagaaatatgtgataatctcggatgcgtgattgaccacagatagaattccaaaaagcaccggtgatcctccaatgtcctgaagatgccagtaaaggaaactgaacaccaaaccagctccaccgcccatcacaacgactgatacgaagaatagaagaatatgcatacttgcaagagccttcattgcaagcagtagactattttcacttccaccaccaccttccgactgcaaaattcgaatttttaaggaaaaatcgagatttgttcaaagtaagtaccttgaacaagatgtaaaattgataaattatagtactacttttttttttattcaatcatcatacctgcgtgattctcgcccttgctttctcagcaacaacatgtgaaacttcagcttctctcgtatccataaccaatccatgaacctctccgggtgcgggaacatcatcatcaaacttgaatttactggccaatcccatggcagccaacataaatatgacacacattacgaaacataacgtataatttttctctgttgtattttcagcaggacatggatgatttcggaatgtatccgaataatcgagtgctattcccataatgaacatagcgaatccccaaccaactgatgccatcaatcgaatctttccgaattcggctggattatcccgtaccgagtgtagagttgctgcgtctgctagaggtaaagcaggagctgagaagaattcacaaaggcagataagaatgagaagaagcatgaaagcttgttcaactgctggttgacggtagacacgagttgagtgaggaggtgagacaaggattccatagttgtcttcgttgtagttgcaaacctgaaacagggccataaatttatattttatcagtaaaactttcaacacagtgacgaacaatttatgtgttttgcttttaaaattgaaattttaaaattagtttttaataatgatagtctgatttattttatgcacaacctgagcaatttcatgaaatctcaccctatcccttgtgatatactccggtgcaattccagcaactgtatcttcttcactatcaaatgagctcaaatcgataattttttccacgagcgctgaaattaaaataatttattttgaatcttatctctgaattaatcttacgactctgagtttgcctcctctgcctggcaggtctagttgatccaccaacaagtgtctctttgagcattccaagagctccacctcgaatgatttttccagccggggctaacatagtttggcatgttttattgccttctgca