Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:305e8   

TH:305e8RNAiTH:305e8
PCR_productTH:305e8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C29E4.8 Source_evidenceePCR827WS150 Sequence/Annotation Release
Chunk_score Abs_score717
Max_abs_score717C29E4.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII79501767952138
Overlaps_transcript C29E4.8.2 Source_evidenceePCR758WS150 Sequence/Annotation Release
C29E4.8.1 Source_evidenceePCR827WS150 Sequence/Annotation Release
WB_DNA_textTH:305e81963agccattagacgaatgagacgcgttcctgaaaattttctggtgtttttaaaacttttggaataatgaatcacatactcggcatttagtgccccttttctcccacctttttgccggaaggaaacaaatggcgatagctaggaggcaaaaaggtgggaggaaggtggcaaaaggatggacggaaagtgggaagcccaaaaaaacagcggatctaaattccgagtagtgtaaagaaacgcctatgatcatattccaattttcttcatttctaagatcttcaataaatagttcaattctgtaccttcttctgggtaaatttggcgaagacttgatcaatatgagccttcacgtcagtcattggctttgcggcatcaacggccacatgaactccgtgttttttgtaatagtcgacgagaggaacggtctgaaaagtattggttatattcgttctcttggatcaatttgaaaatacaattcaaaatgcaacaactacataccatttggtgatattgtacaagtctctttctaagagtctcctcgttatcatcagaacggcgaatcagtggctctccagtgagatcgtccttcattggaacctttggtggcttgaattccaaatggtagcttcttccggaagcaatatggaacagacgaccagtgatacggcgaacaagcaaatcatcggcaatgttgaactcgacgacagtatccaaaggtgtcttccgacgttcgaggatctcatcaagctgaaataatgcattttagattttataggcaaatattttcaagagaactcatctaactttcatagaaaatattaataagaatgagacacgttgtcttctttaataaattaattttacccaccttctccgcttgtccactggtgcgagggaaaccatccaaaatgaatccgtacttgcattccggtttctccagcttttgctcgataagtttgcagaccacctcgtcactgactaactttccagcatccattgttgctttcagctcctttccaaactcggagccagaggcaacttcagcacggagcagatctcctaaaattttgaaaaattcatcaaatatctattttgtaagaaaaaactcattagtctggagttatttctacgaaaaacattttttttccgaataaaaaattccttgacttgaaaacctaccagttgccaaatgacacgagaaatatttctgagcgaaagcgggagcttgagttcctttgccggatcctggtggcccaatgaagatggcacgaattccacgagccaaagtttccgtaggccccgctgattgagtagctggctgagcactttgttgtgttttcgggactcccatagctgaaattatcaaattaaattatttggaaaaaaactattagagccgtgattgcttgaagagcttgtaaaaagcaaaaatcgataatatgcgaacaatgcaataccagtttagaattaattttaatttcaatttcaaaccatttttcaactaaacaataattgattttgctgaaaactcagattttttttaaaattaatgataatcgtagatgttgttaatattgaaataaaaaccatcaaactaacgaactctttggtgtattcaaagaacaatcggtcttgcgagtgaacgagacggcaatttcgagcgaaatgagtgaaaacttcgatagaaattgataaacgagagaggttaacacgcaaggaaaaaatcaaaaggaaatgtgattatttttcaagaaaaaatggggcgacgttaacgtaaaattgtagttatggaaaattaagtcgagcggcagtaattcaagttattcaaaaccgggcttaacattgtaaatccggaagaaaaaaaaggactttctagcgtctgaaatagattatcaactacatttatcgtaaaaacggctttcttatcacttattgatgaaaaataactggagaaatgcaaggaaaa