Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:306B5   

TH:306B5RNAiTH:306B5
PCR_productTH:306B5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54F2.9 Source_evidenceePCR907WS150 Sequence/Annotation Release
Overlaps_Gene F54F2.9 Source_evidenceePCR907WS150 Sequence/Annotation Release
Chunk_score Abs_score823
Max_abs_score823F54F2.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII88253028826836
Overlaps_transcriptF54F2.9 Source_evidenceePCR907WS150 Sequence/Annotation Release
WB_DNA_textTH:306B51535gccaattgcttgaatctgaccatcacttgtttcttcgttttgcttccaatttcttcggagattctttcccacctgaaatttaatatttaaaacattcctctggatattatattatggggacccagaaattttaccgtcaatacctaacgaaacccaacgcttggaggatgagcgttctcaatttcaaaatacccatttctagtttccaagctaacctttcatcagttccctttggatatttctgcaatgcggtttcaaaagccttctgctcagcttgactccaatcatcttctgatttctcttcaactggtactgattgttgaatagttgtcatcaacaatttcgtataatcctcttgcttcatctgtttcatttttccagccattgcaataacgtcttctgcacttctattcaaaactcgacccatttgttcccaacgattcggtgttccagccgggtatttttcagtgctcagtcgaaccagactagctaattcatcaggcgtccatgttgctccagattgttctgaaattaaaagatcattgagtagagttcagaaaccttttttctgataaattaacttactctgtgctacaacttcattttctgctgcatactttttctccatctcaggatcatttgtggaaactgctttcataccttgagccacttcaaatttaaactctagttgctggggtgccgctgctgctctttgttgccttctctgttgagccaactcctcttctgttggttcttcaggttcaacttctttaggtgtcatagcatctttagcagtcaatgccaagtttttgaagagggttactgtacctctagcaagaataattggaagaagttctgaatattttggaagatactcttcaagtgcttgtttcatcaatttttctgcttccgctggatcttcttttttcgattttcgcgattttttcacattttgtttgtagacaagagttttctcgaaatatgccgcccacatcatcaggtaatgagcgatagttccgataaaaagaagcacaaggattccttcataccatgcaagttttcgcattcgtctggaaaaaattatttataaaacactattttaaaaaaatccgaattatttcagttaaccatgtgatatggaatatggtggaatgggaaggaaaatattttggtatttctgccaatttttaagactaacacattgcattttatttctgaatttgatcagatttaagattgtcacgcaacttttattgggcaaacctagttactttttttttgaaaccatcgcaaaacgtataatagcaatggggatttttttaaactatttatatgattaattggaaaactcattcaaattttaagaatatatttacagtcaaaaagcataattttttaagaaaaacaataacaatcttatgtagttttctcgtatttttctgtacattttttttccaattttcaaaaataaaaaccactatgtgaattccctcacctatagtaatacataggatgcctccacgaaggtaacccat