Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:306F7   

TH:306F7RNAiTH:306F7
PCR_productTH:306F7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF11H8.2 Source_evidenceePCR730WS150 Sequence/Annotation Release
Overlaps_Gene C06E8.1 Source_evidenceePCR348WS150 Sequence/Annotation Release
Map_statusBottom50_percentile_ePCRIII70141727016464
F11H8.2 Source_evidenceePCR730WS150 Sequence/Annotation Release
Map_statusBest_ePCRIII70141727016464
Overlaps_transcript C06E8.1 Source_evidenceePCR348WS150 Sequence/Annotation Release
F11H8.2 Source_evidenceePCR730WS150 Sequence/Annotation Release
WB_DNA_textTH:306F72292gccttggtttacctgatagccagtccaaagactaaagtaaaaagttcagaccaaaaactcaaaatgagaggctcaacactaacattggaaggataatagttcttttggaacgacttcgtttgtttctgtgatgacgtggtgatgggagctgctagtcttctccttttacttgtctttgtgtcttctgtcttcttctgtcttccactcacatacactcaactcttgggagttcagcgtagaaataagaaaacgaagaagagtcggatggagggatttgcacgcaattagaggtgctcaatgagcagaccaatgggaaagtgtatgagaagagagatgtgagaagaaggagcagaagaagaagcttcagatctgaaagagaaacagagagacaaaaaatacaattaggatagggtagaaaggttcaagaaagtgtgacgacggaaatagttcactaggaatgtctaatttggttgtacttacctaagagtttcatgaactcaacaaaacagaaacgaatgtccagtgattcttcaataagtgcctcagctcatagttatgattgttctgaagttcctaggtctcagatcaaggttcagttgaattggtatcaaatggcctatctgccttcaggacaacttacgactgccaaagtacacgcgaaacattgtcgatttataagtatgcggtacgtagccgcaaacgcagtaggcttgattagagagtgatgttcataaaaaattaagattagaaaactctaaattcgtcacacattttttgtcaaaacccatacaaattctggtcataatgacgtcttactcacctaaatagctcgatatattttgtgcatttttgttttccgaaatctatatttgtttctattatgttccctttatgcatagtagacaacgaagctaataatttgtaaaatactcatctctgcaatgccaacaagtttttgctagaaactttgagtagggagacacatctccaataaattgaattaaatcaggtctcctcaatttttctttcactaggtggtctttttgtaggcaaaactttgaaagggaagctttgcgtttaatatttgtaaatacaacttatcactgattttttgaaatttcagctaccctaaactggtttccaattaggaatgatcagggtgtcgcattcacggaaaagcagcattaaaatttgaacatcggcacgtcaaaatatatctttggtctctgctttgacctcaatctgcaaagcttctagttaaataatattgtgctttgaatccaaaaaatatccccgaaagaagttcttccctcactcacaagagtatcagttatgcaccctcgaaccgaaaaagaaggaagtgcgcacatacataggtgtcaccaacacaaagaaatttgcggaaacttgatttttcggtgtactagaagaagaagaagttgagcttctgtgtggagagtgttgcaaaaaagattttgagggtggtgggcgaaaggtcacgaggaaataatatagggaacgactataagggatcagaaaagtgagatttaaaaacattcggatttgtgctagacttgcagccaaaatgagcaattacagtatcagagaattgggatgagtttcaagaagttagattcccatacaagggcacttacgtaggccttttggagccatatcagcgagcaaacacagtactattgattatctatcaaaatggtgtcgaatagacagtacatagacagatatatgcgcctgaagatgcgcaaccattaaactcttacttacaggatacataacgtactgtttttctttgaattatcacgatcgctgacaactgttggtttctaaatttttataaaatattttgaactttctgagtcttcttgacctattaactcatgtattcatcttaacattttttgatttctggcatttccaattagcgtcatcctgtaccagatacgaactgaaagcacttcagtctcatatttaagatgacctctttttctcgtcttctgagaaatgagataccttgactcttgtctctttccaaacatgtctcttgttttcatttcaagtctgttattccgaatgtcatgtcacattttgatacatttgactcggatttcgcctctccgtttagtttctcggaatggaagggaaacaacggagaaaaattgatgatgaacatatcggaatgacgagaagtgaaatggaaatttgaaataataagagacgtttattgaaaatgaagaatacaatttcaggggcgaaagtaacgaaaatttggaa