Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:306G8   

TH:306G8RNAiTH:306G8
PCR_productTH:306G8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34E10.7 Source_evidenceePCR579WS150 Sequence/Annotation Release
Overlaps_Gene C34E10.7 Source_evidenceePCR579WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII52406205242644
Overlaps_transcriptC34E10.7 Source_evidenceePCR579WS150 Sequence/Annotation Release
WB_DNA_textTH:306G82025cagacccgtaaccaaacaaatcagaaatcaaagaaagagactctcaacaaatatttgaaaaaaaaccgaaacttatggtgaataattaaaagtattctgatgggaatgttgatgatacatttgttgatattgtggatcacatgatccttgaagtggagcagctgatggttgagttggagaataataatattgaggtggagaacatgaagatgatggtgatgatgatgagaaggatgaatgtggtggtggatgagatggatgaagttgatgatgggatggatcagagaagatgtcgaattgtgatggtggaaggagttgacgaggttggacctggaaaagagaggggatatggagattttgggtagtaaattgtttttactctaacaaaatatggtaaatgtgtaagaaaaaatgggttatacaaagcccaaatcttttagattcatctattcgaaaaaattatttctcatttaaaaatacagcacgcggtctcgacacttgttttgtaaatcagctaacaagaagataggcaaactacagtactaaacatttcctatgagtttaatattttgactatgtttaaattaactgtatttgaaacttctggaggactccgaaaattcaacaactagttaatttcgctagcgaaaaactatcttatgacttctaacttcagttataagacaataccaagttatttaatgaaatgctctcaaaaccttacctgcaacaagttagccaacatattcgtggtagtctgtgacaatccattggcaagtgtgtgagcatattcaagtggagttggttgttcgtttgtttgcaacattctttgaagagcatcaatgtaattcctgaaatatttgaattaatttggaaatattttatgggtttaatgatgactatgttcatagttaaatcgttaaaattcttatttggaacgggggagaatcataaaacttaatgacagcgagctggtaattaagaagagtctttctatattctattctattcaagacggcttggaaattatataaatcacggaattaattatgaaaattgaaaaaaaagttattacctcgttttggaaaaaatgtatttaaaaaatctaaacttttaaagcgaagtttcagttaattagaaacactttagaaaaattagaagaaagcgccaaataacaaaaaatcttaccttgcgagtctcaaagtctcaattttgctaagtttctgatgttgagtagtaattggaatatactctctgagcatatccaatgcattattcaaaccatgcattcttgctctttctcttccatttgctttcactcgtcgaacttttcgctttgaaatttcggctggagcaaagtttgaagtatcagtaggacgcattgtagaaaatataactggatgacagggaagtgtatagtgaaagagaatgagctactgatctggtggatggttcacagaaggaggggcggggctggtggagctgggtgaacagagagcccgtggtgtacaaaaggggcgggatgttcgttgggaaggatggaatggtttccaatgatagcattaaaaagttctaaaaagataaatttacagatgaaactttcgaaaaagtttaatgttgatgtgtcttacaatcagattttagaaaacttgcttaaaataggaaccttgcatagaaaaatacttttaaaaaaaacttttagctctactttatctactttttagaaaacaaaatatcaaaatgttctaagtataccaacaaggcaaaggactcttaattatgttccaactaaaaaactgcattccaaaaagttaatatttttgaatgtatgtgccaaacttgtaacatgatcgacactattgactataaatattaaaatacgaagctttataacatgtgtggaatggtgttccacatttcaataaatcccttccaatagataaaaaatttgttctgaaaacgatccagttaacaaaaacgctcgtgcttgtaattttaaaaatcttgaaacatgctagaaatcgt