Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:307D9   

TH:307D9RNAiTH:307D9
PCR_productTH:307D9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F37C12.1 Source_evidenceePCR667WS150 Sequence/Annotation Release
F37C12.14 Source_evidenceePCR432WS150 Sequence/Annotation Release
Overlaps_Gene F37C12.1 Source_evidenceePCR667WS150 Sequence/Annotation Release
Chunk_score Abs_score520
Max_abs_score520F37C12.1
Specificity_index0.607
Rel_score1
Map_statusBest_ePCRIII71842617186496
F37C12.14 Source_evidenceePCR432WS150 Sequence/Annotation Release
Chunk_score Abs_score337
Specificity_index0.393
Rel_score0.648
Map_statusTop50_percentile_ePCRIII71842617186496
Overlaps_transcript F37C12.14 Source_evidenceePCR432WS150 Sequence/Annotation Release
F37C12.1 Source_evidenceePCR667WS150 Sequence/Annotation Release
WB_DNA_textTH:307D92236ggtgatcaacaatgacaggaaccgagagaaaagttttccaggtgaggaagattctaaagtactatcctacatgcttttttgctagtttaaatatgaaaaattgcagaaaaaacagttaaaaaagagtacctttgttaatttatttctaacttcagaaatactatccaccggatttcgatccatcaaaaataccacgagcaaagggacagaaaaacaggttagttttgtttttaatttagttcttcatttattttttttcgttttacagacaattcgttcaacgtgttatgacaccatttaacatgcaatgcaatacatgccatgagtatatttataaaggtaatttgtgattttgttcactgaagcaaaaaaaaaccattaaaaaaataaaattttaatctccaaaaaatctttatgtgttattctaaattttcaggtaaaaagttcaacatgaagcgtgaaacggctgaaggagaaacgtatctcggtttgaaactgttccgattctatttccgatgtcctaattgcctcgctgaaattactttcaagactgatttggaaaactgtgattatcagaatgagcatggagcaacaagactttttgaagctgtcaaagtgagtgtttagataatttttatttgaaaaagcacaaaaaactttatttgcaaataagttatgttgagttatacatttttagtagctaacagtccatacgagtgagctgaggcatatctgaattataaaaaatattatgtttttgagtattccgacgtacctgagtagtcagccttttccactttgaagtcatactctgaattctcctaaaaatacaatttattttgaaatccatatactttggaatcttaccctcttaaaatctaggtgactgctattttcaacttcgatttccattggcttttctggttccaaaagatgcataggttgatcttcagtcagttgaataatatttgaataaaatgtatttagattaggaatcgaaaatttccacatctgattttgaacttgactgtacataatcactgggctctagaaatgcgatatagaccttaattgtctgaatctgtactcaccgagattgaaaaaaatgtgtagatacttgtaggtggtggacaccaaatgccatttagtggtgcaaagtaatagaaattgggaagaggcgttgtcatgagaatgattatttcaagatgatctctgtcaaaaataaaagatgaaggaagtgacatagaaactaagaataattgcattggctatgaaagcttggctaggcagcagaaaaacttcaatacttgacggtttcaggattcaaagaaaaccatagagatttatttatgagagtgtttttcgacaaaaaatctttgaaaatactacggtatgccacgagaaatcattagaaagatgagaaaaggctgtgggtgtgtataattgaagagtttgagatgtttcctcggcaacaaagagcttatgagaacaatgacaggatatagaaaaggattagattaaatatatgagaaggagtgactatgaaacatttagtttgaaaattccaaaaaaaattatgaggtcatgataaatctaaccgttggaaagaaaacaactagttataaaagataattatataatcaatatttttcacaaaaattgaccaaattagctttcattttagttaaaacctttgaaaaatgctcaaaaattgtctgaaagtagtgacaaatgcccggaattttccgagaagttccaacttttcatttttaatattaaaaaattatctggatcatctaaaatttgaaagtttttgtccaaaaattcgaataaaagatatgcaacgtttataatttaattttcagctttaccaagatcaacaaaaacaagtggatgaacaagaagcagaagatgcgaaggatcccatgaaaatgctcgaaaagagaacaatgcaaagtcgtcaagaaatggaagaaatgggaaatctggaagatcttcaagaatcaagcagaacgaaagaatgtatcgacaccattggtttcttgtcgtcaactgatcctcatatcgcacaagctcagagaattaaaatgatggaggacgaggatgatcgaatggcaaggtatgtcaagatattaaaagaaattagaaaaatcaagaattttcagagaactcatgggaatcacttcagaaggacgaatcgagcgacgtattaaggatgatgaggataactcagatg