Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:307G9   

TH:307G9RNAiTH:307G9
PCR_productTH:307G9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0361.4 Source_evidenceePCR870WS150 Sequence/Annotation Release
Overlaps_Gene B0361.4 Source_evidenceePCR870WS150 Sequence/Annotation Release
Chunk_score Abs_score765
Max_abs_score765B0361.4
Specificity_index0.852
Rel_score1
Map_statusBest_ePCRIII72662687268490
B0361.5 Source_evidenceePCR154WS150 Sequence/Annotation Release
Chunk_score Abs_score133
Specificity_index0.148
Rel_score0.174
Map_statusBottom50_percentile_ePCRIII72662687268490
Overlaps_transcript B0361.4 Source_evidenceePCR870WS150 Sequence/Annotation Release
B0361.5b Source_evidenceePCR154WS150 Sequence/Annotation Release
WB_DNA_textTH:307G92223cgcgcgatattctttgtattcaaagttaaaaaggttcgagtttttgaattttcaaaaaagcttaaaagtcacaaaggtcgagcacagtgcactatcattagtttcgcatatatagaaaatacatcatttttgtattatgagagtatatgaaaacatgcattccatgtcgatgatgcgattaactgaacaattttcaggcggtagctgcacaacaaaacaaagatgataaaactggaggaagtggtggaaggaaggcaagtagtggattggtaccatcacttaatagactacgaattcaacaatgttttaaagcagcaaagtgagttgaatctttattttcagaatttttgaatgtgtcaatagactttgccaagtttgattctatactacacccacatcataaactattcacatatttcattggtattttaactgtaagagtaactaaatcaaacacgctggctacattaccagtggacgtttctatagtgtagtcgttacaacttataaatatacttaatgttccataagtcttatgttggtattttatattctgagatccgaattctgttcatttccagaccatcaatcggtgatgcaataatgaaaagagcggcagcgtcgcgagcggaaatgagaacaatgttatcgaaaatgaatgagaaacaaatcgaatgtctgggcaaacaaatgttcgaattgattactgatgctgtcgaaaatgctgataagtccgagaaggtaagggctttttttcgacgagaagatgaatattacaaatgaatattggaaagttcaataaaattttaaacattgtctttttagccatcagttgaacgttttctatgaattctaatcttcattcactttgtatttgatattcttcggatttcaaatccatacctaaagctattttactgaaaatgacttatttgtcaagtacgatgtgaatttaattccatgtaaagaatatattgacgtaaatcaagaatgtagataatctataatcttgattttgaatcaaatccattaaacttttatatcaaaatataccaatgacatttatatctaagtttggaaactttatttggaaaagttagggaaaatactttatccacaaatccacttttacagttcaaaatacaatgaacggtgactggtgcgattttataggtttcctttcgtggtatttctgaacttttgattattttttggtaattaaagcatgtccacaactcacgctactccacctctaatgtcaaaatgtatcttttcttcaccaaaaagtatatattccaggttctcacacacgcccgacaactcggtggaacatatgcatctttatgtcctttgggcttccgacctgatctcttcgcccctcttgctgatgcagcaattgcagaatgtgtcaaacttgatggagttcataaaagatgtgaaacattgtctgcatggagccaactattctctgctttgttcactggtgtacgagatggttattatcaaagagtacggcatcagagaagaacttcgttaccgcagaatactatcacgaaacaggtaaaaatttgctaactttttttgataactcttgatttcgggaaaaggtgaaaaaaaatcaattcaaagttgcgcgtggaatgtgatgcagcaattgttgagagaagtttgcaaaaaccgtacaaatgcggcacattctacgcgcaaattttatatttttacaaaacctttttaatggaaaacaagaataattgaaactgaagtatatacctaataggaagtaacatgccggcattatttttgataaattcttaaaatttcataaattttcagctttccgtcgacttttcgaaaacatccgacacgagcttcgtccgataaatacctgaagccttcaataattgtttccaactatttttctcttcataagataatctcatcaatttttgctgtaaatagttttttcttcactgaaaaaagaaaagcacatttccatttcaatttctcatcttcttcctttcatccagggtttgtgtatgttgatctcaaatcatcaatatattcatgttatttttcaatcatttattatttttattattttttctctatttttttttgaataaatctttcaaacatgaaaagaaaataaatataagaaaagtgaaatgctaaaaaaagagttgtaaggggagcgttgtacccgacataggagcaacagacaac