Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:308C2   

TH:308C2RNAiTH:308C2
PCR_productTH:308C2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST04A8.4 Source_evidenceePCR791WS150 Sequence/Annotation Release
Overlaps_Gene T04A8.4 Source_evidenceePCR791WS150 Sequence/Annotation Release
Chunk_score Specificity_index0.909
Rel_score1
Map_statusUnique_ePCRIII46852904687027
F10F2.7 Chunk_score Abs_score69
Specificity_index0.091
Rel_score0.101
WBGene00044078 Chunk_score Abs_score686
Max_abs_score686WBGene00044078
Overlaps_transcriptT04A8.4 Source_evidenceePCR791WS150 Sequence/Annotation Release
WB_DNA_textTH:308C21738actgaggaggcttgaagagatatgatcagttgaagagatccattatatcagtagataaatcatatatctgtaccttgtatccatttctggcacgataagtttgctctccaccccaaaattcgcacatttgctggaaactccaatctctgtccacttgagcatttgtgtagcacaaaaggcataaacccatgaaaattttcaaacgcattctgcgaatgagatgaatctgaaatgagtttttgattaactcgagagaaattgtagaactcaccttatacctatttaatgttggtactgagtttgttgtgtcagatattccgtatttatattaatttttccttcatttgcctttgaggctaaatgagttcacgtgaattttaatgttatgaaaactaaataaatatacaaaataaatgattggaaaaataaataaaaatgttattcttttgattgaactgggagcttctggcacttgaaaaaaaaatttagttatatagttaaaaacagctaaaattgcaaacaagtccccgaaaaaacattttgaaaaaagttaaatttgagtgagatttgaatttttaaagttatgaaaatttaataaatatccctataattccctataacaactaaaaaatacggtcaaacatatgtctgaaaattgggtcttttgagtgaactggaagcatgtcaacctgtagattaaaatttccacgttggtgccttcaaggcgacctatcctaggcagggcaaacttttatgtttcttcaacaataaattcaacaagctcaatttatatcattcaatttgtgacaagaacagggaaataacaaaacacgtgggcaatatgttcggaaaaaagtgtttaataactgcaaaatacaggggcttttgatgtgtcttttggtgtccatggcttcttgggtctaccctgaacgggaagagaatctgtgtttggtggtggcggggcttcgaattttctgaaaaattggaatggcgattttattttttttctctcaaaaatcttgaattgaaaactgtggtagtttcattggggtagagaaagtgacactcacgcttttgaagatgtaactgaatcacttcttatcggtcgaggtctaggagcttctttagatactggaggcacaaatgcaacaggttctgaattgcgacgaatttgaatgcaatttgcaggatctccagaagctgtcaaactttctcgaatttcttgaagactcatcaacattgtgattatcttctcgtcatcttgtctttgatataacatttctccttcaaagtgtacaagaccatatttccgagcacgaatcagcattccaacaagctaaaaatataggattgacgtaaaatagaaagctaagatcactaaccttatctgaataaaaggaataaatattgaaaagttttccgaatttcacatatttgtgcggctcttctccatctgcattcgagtctattgtttcgcagaggaatagaatctcacggcacacatgaacaccagcctgaaaattcagttaatttagactttgatttgtggaattgtgcaagctttacttgtgcaggcacaaagcgtgcctataacataggcacaactttcctgctctttttttttcaaaaactaacttacataccttgattcctcttgcctctgtcttacttcctggcggtggtcttccatagttttttgtgtcaaatgcctgaattttgtacgtgtcggagtatggat