Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:308E1   

TH:308E1RNAiTH:308E1
PCR_productTH:308E1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC16C10.6 Source_evidenceePCR1078WS150 Sequence/Annotation Release
Overlaps_Gene C16C10.6 Source_evidenceePCR1078WS150 Sequence/Annotation Release
Chunk_score Abs_score1015
Max_abs_score1015C16C10.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII41671234168809
Overlaps_transcriptC16C10.6 Source_evidenceePCR1078WS150 Sequence/Annotation Release
WB_DNA_textTH:308E11687tgagtccgtctaatcttgcttctttatcgattttcttcggcttcagcttatctttaagcgagattttcggcgctttttcagatttttcagatttcccttcaggcgatcttctactccctgattctctcgattctatggacttccttgaagttggtgacgggcttgaagtccttctccgagctcgtggagctcttgcaccttcatcatctgaagatggaggtgttggagtgtagtttcgctgacggattctctctgcgtgagtcgttgcttttttttttgataccgtattcaggccaggtttaagatctccttcgaaatttttttgtggaggttttggtgctttttcctcgtcagaatcatcggaataaattgattttttaagcttttcggctggtttcttatccgatttttccggtttcggatcaatttcttcatcagaatcttcccgttttctcacatttttctgctctttcttcctctgtttaatagctgtaggatctcttgccaaatcgtttaaaagcgtccttcccataccaatttcccataatttctgtttctgaacacttgtcatatcattaaaagcagcttcttcagcttcttgttcccgatgtttcttcacttcttcctgttgcttacggtatgctccagttacaaaaacttctttatcatcaaattcatcgccttctttctctcgttctctgagttgttggcgttcttcacgagaaaattgttcgagttggcgacgagcatgggctttaatgatgttctccgcgtatttcgattcacgatttttgtccgcttttcgagcttcttctttctgcaaaaacaaagctgttagttgaatttttcagcctaaaaatactgaaacttctgaaacaaaccatttttggttaaagatgtgtttttttttcttttttaacgaaaaattttcgattctctaaaaacccgaaaaatcgaaaatgttcgtttattcttgtccattttttagatttaaaaaaatatcaaaattgttagtggaaacttattatataaattgttttatttgttgaaaatttttttttcatattttcttatcgaaaattctttgttaatggttttaaaatctacactttttcgttttatttttagtattttttttttcgattttcaacttttcgagccctcactttttcattcttaatcgcctgaatttcatcgtaattcccgtcataatcgaaaatcgtcggatcctcggcttctgccttttgatgttctcgttctgctgctttttgcacacgaataactgaagctgatgccatattggtagctgtggctggctgaaaagtaagaaatttataattcagaaatttataaaagcttttctaaatcgaaaaatagtcaaaaactaaaaatgtttaaaattgctagtaggaaaaaattatttttgataattttcggtcatttctttgttgtttgaaaactttttctcctacactaaatttttcaaacttctctgaattttaccacattatcatcatcatcatcgtctccaaaaacactggaaactcgaattggagcagctttcggttcatcttttttccgaatatttaatcctacatgccgttttgatgccatctaaaaacttttttattttatttttccaattaaaagaatccaaaggatacagtttcagatataaaacaccgct