Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:309A6_1   

TH:309A6_1RNAiTH:309A6_1
PCR_productTH:309A6_1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZC262.5 Source_evidenceePCR165WS150 Sequence/Annotation Release
R05D3.6 Source_evidenceePCR165WS150 Sequence/Annotation Release
Overlaps_Gene ZC262.5 Source_evidenceePCR165WS150 Sequence/Annotation Release
Chunk_score Abs_score123
Max_abs_score123ZC262.5
Specificity_index0.5
Map_statusBest_ePCRIII83419338342532
R05D3.6 Source_evidenceePCR165WS150 Sequence/Annotation Release
Chunk_score Abs_score123
Max_abs_score123R05D3.6
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRIII83501288350727
Overlaps_transcript ZC262.5 Source_evidenceePCR165WS150 Sequence/Annotation Release
R05D3.6 Source_evidenceePCR165WS150 Sequence/Annotation Release
WB_DNA_textTH:309A6_1600tccgggagtttgttttgtcggatttttattattctggtcaatactcattttttctcactttttcaaacgctttcaaacaaaactaagagtttattattgcacacaaatcaataaaaaatgcggaaaatggcatattgcaccgaacttgatgaaacctatttgtttatttttttctcaaatggaaatgatcaattatcgaatgaatctattgagacttggacaccatctttccattctcccaagcagtggtcttcaaggtggcttggggcttcttcacgttggcgcctccctgtaatttttgataatttttgcgatttttcatactttgatgtgggacaaaaatgtgtgaacctttaggagcccagtaattaattaccggtaattttcagaaacatattacttaattgaaacctataggttataacttgaaaaatgataaacagaaaattaacggaacgggttactgtaccacttaaaggggcatatattgttatttaagggtccaacaaaccttggtgcactgacgaacgacttgtgcggcgatttgtgaataacggacgtagttgagtccagcagctctccaggcgaccatttttgatt