Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:309D8_1   

TH:309D8_1RNAiTH:309D8_1
PCR_productTH:309D8_1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZC262.1 Source_evidenceePCR183WS150 Sequence/Annotation Release
R05D3.5 Source_evidenceePCR183WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcript ZC262.1 Source_evidenceePCR183WS150 Sequence/Annotation Release
R05D3.5 Source_evidenceePCR183WS150 Sequence/Annotation Release
WB_DNA_textTH:309D8_12154cattcactaggcgcctttatagtagaatcaacaaaagatatattaatccaactgataaagattacaaaactgccatggaacgtgacgaactattcgacctccaaaccttaagcacgagacgtaaaataattgacagaatccaagtaatcagaatgaatactggtaaagtagacttaaaaacatctgagttctttgagcaacaagagacccacactcgttctaaaaagaaatatatctggagtacagataaatctaaacttaggattcacttttttgtcaacagaacactacccacaatgaagcaacactaatctaatgttaccttatcctcacttctatccatcatttattcttgccttttatacatcgatatttgtgttttttgcttcttctccaatgtagccattattttcttctcatctcttttttatttttgtttcgttttatttatgtaatttatttatgtaaccacttgtgatggtttgtatctattaatgtgtgtttttttttctacctcacgatatcttactatcgtaataaattaaattaaattaaaatcaaagtctagaggtacagtacttcaagtggtccaaaaacctgaagatctttttttgaggaaactagttttgaaagtttcagtgctagaaaatacactttatatcaaaaaacaaatacaaaatgttttatttactttttcttaatattgaacgtatatgatctatgaacttttattgcttcaataactgaaggcatcttctgccaataaaaaagttttataaaactgtaaaattagaagaattcagtattccagggtatagattgaaacagcttgcctgcctaacaggcgacaaatgactgtggcatgcctacactcgttccctctgtaaaaatcccgcgtattgcaattttaaaactaaacgcttatttcattttacaaaataaaacgtgaaggttcagtttttatatctgacgtttgattgttgaggaaatatgacagtcaaactcttatttcaattatttcaactttattttctgctcatttatagcagcttggaggtaagtaatcttcaaagatttttcaaacgtttcagaatttgaatctgttttcagaactaacaaatgggtgataaaaaatcaccggttgctgttggtatgacggttcttccaccaaatcaagaaaattttgttgatgctggatcaactacattgatgaataaacccggtgaaccgattttcaaattggccattaatctgacaaagtaagttactgagtctacattcgaggcgacatatacctgccatttgcctactttcgcctactgtcaaaatacacagttaattcacgatgtgcgcatgatgcctcagtaagaatcattcacatatcgcaatcgaggatcgagcacatcaaagcagccgtttgcaagtgcagaaagcaagcggctaacaggcatgtaggcaggcgtaaatcaagaacgaactttaaaaacacattttcaacagttcttgaatagctttgtgttcattcctataaattcctgaataagactcaatctaattgtaggttgaattcaagtgcacagaagatcgaaaaccaatatcagtaaacttgaagttgcacaatccaacggctgtaactgtttcgtacaaagttcgttgcacgtctgcagatatttttcgtgtccaacctccactgggatttgtaaagccgagtgaaacagtttcaattgtgatttggtatcagaatcaagacaagaaagatgcaatctcaaagaatcactatttcgctttttaccataccaacagcgatggaagaactgctcgtgaattatgggcaaattcgaaagttgaaggttacacttaaaattggaatatctagtttttaatgtattatttcaggtgtccgtcgtctccctgcttcgtttttatcgactaagtgaactttgatcgaatgaaaatattgtcatttgtcatttgtattattcaactacattaaatttagagtttaatggtgcatgaatcattttccaggactcggcgcgattttttatggaggctgaagttctgtattaatttaacaactgtacttcttcttcatttgaaatatttttaaacactgccatgcgttctagcacgagcgaaacttgtaagccaccg