Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:309H9   

TH:309H9RNAiTH:309H9
PCR_productTH:309H9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C06G4.2c Source_evidenceePCR342WS150 Sequence/Annotation Release
C06G4.2d Source_evidenceePCR226WS150 Sequence/Annotation Release
Overlaps_Gene C06G4.2 Source_evidenceePCR342WS150 Sequence/Annotation Release
Chunk_score Abs_score279
Max_abs_score279C06G4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII79809087981580
Overlaps_transcript C06G4.2a.2 Source_evidenceePCR321WS150 Sequence/Annotation Release
C06G4.2a.1 Source_evidenceePCR328WS150 Sequence/Annotation Release
C06G4.2c Source_evidenceePCR342WS150 Sequence/Annotation Release
C06G4.2d Source_evidenceePCR226WS150 Sequence/Annotation Release
C06G4.2b.1 Source_evidenceePCR321WS150 Sequence/Annotation Release
C06G4.2b.3 Source_evidenceePCR321WS150 Sequence/Annotation Release
C06G4.2b.2 Source_evidenceePCR321WS150 Sequence/Annotation Release
WB_DNA_textTH:309H9673gttgtgagcctgattgctctgcttcttctgactttttcgttgaacaaaaatcaaattttatttcaaattcatagatattctgttttgcagaccccgaaaatcgtgcggcaggctcaaacgaggaggaaaactatcaaaaaaagacaacaaccgacggtttcacagcaaaagccgacggaatcaaaatggctgacgatgaggaagaaattattcaaaaagtcgaagtgaagccggatgaattcaatggattaattggatcaattgctggtaacctgattagagataaggttagtttaatttttggttagaatattttttttttaaatttgctacatagacatgttgaaatttaattgcaacctaaaactaattatctcacaggtcggtggcgccggtggtgatatccttggaggccttgccagtaacttcttcggaggtggaggcggcggaggaggcggcggcggaggcggaggtttcggtggtggaaatggaggattcggtggaggtatttttattttcaaaattgtcagacaaaaattccctaaaaattcaagttcctttttttgtgttagaaaacatttagattcactcaaaacatcaccgtgtggcttagatcagtgaattttttctcacaccttatatgttgtccatgttatcgtaatcccatttgctg