Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:309H9   

TH:309H9RNAiTH:309H9
PCR_productTH:309H9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C06G4.2c Source_evidenceePCR342WS150 Sequence/Annotation Release
C06G4.2d Source_evidenceePCR226WS150 Sequence/Annotation Release
Overlaps_Gene C06G4.2 (3)
Overlaps_transcript (7)
WB_DNA_textTH:309H9673gttgtgagcctgattgctctgcttcttctgactttttcgttgaacaaaaatcaaattttatttcaaattcatagatattctgttttgcagaccccgaaaatcgtgcggcaggctcaaacgaggaggaaaactatcaaaaaaagacaacaaccgacggtttcacagcaaaagccgacggaatcaaaatggctgacgatgaggaagaaattattcaaaaagtcgaagtgaagccggatgaattcaatggattaattggatcaattgctggtaacctgattagagataaggttagtttaatttttggttagaatattttttttttaaatttgctacatagacatgttgaaatttaattgcaacctaaaactaattatctcacaggtcggtggcgccggtggtgatatccttggaggccttgccagtaacttcttcggaggtggaggcggcggaggaggcggcggcggaggcggaggtttcggtggtggaaatggaggattcggtggaggtatttttattttcaaaattgtcagacaaaaattccctaaaaattcaagttcctttttttgtgttagaaaacatttagattcactcaaaacatcaccgtgtggcttagatcagtgaattttttctcacaccttatatgttgtccatgttatcgtaatcccatttgctg