Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:309d6   

TH:309d6RNAiTH:309d6
PCR_productTH:309d6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T26A5.9 Source_evidenceePCR450WS150 Sequence/Annotation Release
Chunk_score Abs_score408
Max_abs_score408T26A5.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64630096463949
Overlaps_transcript T26A5.9.2 Source_evidenceePCR428WS150 Sequence/Annotation Release
T26A5.9.1 Source_evidenceePCR450WS150 Sequence/Annotation Release
WB_DNA_textTH:309d6941atgcgacgaaggaaaatgttttttgggaggaaaaggaagatttaacaagagtgcacactgaagatcctacgccacctaaggtacacgtaggatcaggtcacaatttaaagatcattgaatgttttttaagaacaggatgggatttatccagacttgaatagcaggatggcgacctgtccaaggtagaagtagataaagtgcttagtctcgtgggtcacgtagcttccaaagtttcttccgacgatgcaatgccaggttgggttgtatttcttgtcgaactccttcttgatgtaagcggcaatatccttctcgatgttgtatctgaaaaaaaaatgttttgattttattttttagactttcatcgcttcgcttttttcttgcacaaggatcagatttgttcgatcagctggtcgctcctgctcgccccctcccctagactcgggctgccgtccactttagtttaaatcaagggaccgatgagccgttccaaacagctaaacgacatttctttacactttttctctactaagcgaccaagtgttgttcatggcaatcgaattattcaagcgtttaaaatgcaatgagaaagctcataactcacttctcgagggcctgggtggcgcagtcgatggcgtcctgttgcatgtcatcggacatgtcggcattcttgatcacagccttgcggtcaaccattttgaacggatttggctgcaaaaaatacaaaattaaattaattgaacaccgggtactcggtagtagttataataacggttgtgaatgcggaatgcggaggtcaaagagatagataaggataatggaagaacggcaaggtaattatttgagcgacccaatttatgacacgaaacaggagtatgttagtacgaataaggctcttcagagtattaaaaatataatttgcaaagctcggaggcacttgagta