Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:310E4   

TH:310E4RNAiTH:310E4
PCR_productTH:310E4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K12H4.4 Source_evidenceePCR572WS150 Sequence/Annotation Release
Chunk_score Abs_score488
Max_abs_score488K12H4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII80449838045761
K12H4.5 Source_evidenceePCR6WS150 Sequence/Annotation Release
Overlaps_transcript (3)
WB_DNA_textTH:310E4779cgcactcctagcgttcactctttgggtgatggccgcagtcacagcagcttgtttcctgtcaacagttttcctcgactacactgttccaaccaagctcactgtcaacgatgtcaaagtgtaggttttataagagaaataaaaaaattgcgaaattctttcaagcgtttctccgaaaacattttaaacgtatttctgtaaatcttattccattttcaggagaaacgttgtcgactacgccacggatgagcaacaagccgatctcgccacactaaacttcaatctgaaagtcgatttttcaaagattttcaactggaacgtcaagcaattgtttgtttatttggttgcagaatataaatcgaaagtcaacgtaagctttggaaacttttattgaggatcgaaaaaaacttctttttttttgcaattgtaggaggttaaccaagtggtgctatgggacagaattgtggaacgtgctgaccgtgtggttatggacgagatcggtgtcaagtcaaagtattatttcctcgacgatggaaccaatttgcttaaccacaaaaatgtcacctttgttttgaggtttgaattgaaaattcgataaataaaaccaaatattaaaatatttagatacaacgtgattccaaactctggctatcttcgtcttgttcaatcttccgatcaagttgttgttccgttcccaaccacatacacaactactcgaagatcctagttacatcttattttacttgtttcatatgaaatactatgggttatgtgtttcatcc