Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:310F3   

TH:310F3RNAiTH:310F3
PCR_productTH:310F3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC35D10.5 Source_evidenceePCR548WS150 Sequence/Annotation Release
Overlaps_Gene C35D10.5 Source_evidenceePCR548WS150 Sequence/Annotation Release
Chunk_score Abs_score464
Max_abs_score464C35D10.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII48623304863211
Overlaps_transcriptC35D10.5 Source_evidenceePCR548WS150 Sequence/Annotation Release
WB_DNA_textTH:310F3882aaacattttccgacgcctagctacatcgtctcgagttctttccaatgcgaacaaaaagacagtagaagatatgacgcaagagatgttgcaagtaaatctctgagtaaatatattaaaggcaaaagaaaatttcagatgccagtctcaagagttcctccaactattcaacgattcgcgacatctctaaaaatgaaattcaagtccgacggtcttgatcaatcagtgaaatctattcttgaccgcgcatcagctcaactttattacaattgtgcagataattatgatttcgcaaagctctgtgaggcatttggacttggagattatatgtcttcgtggtaagctttcacctttagttttttaaccattattactccaaaacttcaggtacaagttgacactaatgcatacatggatggtattgatgagacttcattcagaatttgatggaaaagcatacatgagattacagcgaggtcttttatcaacaatgtggctggatattgataataggtaaaaaaataaatttcagagaatactttgaatatatattttcaggctaggaattgtgagcaaagagttgaatcaaattatgacggggcaaaatgatatgaagcacatgcacggattacatttgcagacgtttttcgaatatgacgaggtttgcttaaacacacaatgcggaaaattcgtttacaaaaagctattctagggattcctccacgatgaccgtgttcttgctggtgccatttggagatgcttatacatgaatcgagaagttgatccaattcatttgctgaaagttgtgacatatatgagatctacagttgcttggttggaaacacaggatacgaatcaaattcttgttgaaggaatttccgaatg