Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:310G1   

TH:310G1RNAiTH:310G1
PCR_productTH:310G1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07E12.2 Source_evidenceePCR276WS150 Sequence/Annotation Release
Overlaps_Gene K07E12.2 Source_evidenceePCR276WS150 Sequence/Annotation Release
Chunk_score Abs_score255
Max_abs_score255K07E12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII67371406738053
Overlaps_transcriptK07E12.2 Source_evidenceePCR276WS150 Sequence/Annotation Release
WB_DNA_textTH:310G1914gtcgttggcataaatcgaattataatgaaacaaataaaaacgaccaaaacgtaacgtaagtcaatataagacacgtatcaaaatttcctatagttttcggattattttgaactttccaatttgagtcaatggaggtgtctagattgtaagctttattatttccaaagtctggttaaatacaagatttgatttcagttgtgaggagaaggaaatcaacaattaccaaagtcagttggaggctcggaaactgaaacgtcaagagctcatggaaaagtttgcaaaagagcgacataaaagaaaccgggagaaggaactgaaaaagttgtccgagggtcgaggaaaatggttcaagggtgtagaaactagaaaatcaaataaggagaaaaagaagaattcgaagaagatcgaggatgcaaagaataatgagggaagttctggagcgttgaaaatggaacaggaatgttgtctggaaaacgtgaaggaaaaagtcgtgaagatgatcagtgttgtcaaggcggagattaagaaggaagaagtatagatgaagatggtaacaatcaatgattatgaattaaaagggagaatgtgaataaatttcgagacatagacgcatataaacgcatagatacatcgtttataacaaattgtgaattttctggctttcttggcgtttcagaaaacttcgaagacgaatttcccgaaacccgtctggttgagtttttagtagccctgaaagagtatgtttcaagaaacctagaaattgtgttaattatttacttgaaaaatctggaaataaaattatggagtacattatggagtacacattcgaaacgttttacattgtgaattttgagaaatttagaaatttacttcgagcgaactgattactaattcataagatttctccgtcgtcg