Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:311C4   

TH:311C4RNAiTH:311C4
PCR_productTH:311C4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06E1.5 Source_evidenceePCR153WS150 Sequence/Annotation Release
Overlaps_Gene C06E1.5 Source_evidenceePCR153WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII85890678589590
Overlaps_transcriptC06E1.5 Source_evidenceePCR153WS150 Sequence/Annotation Release
WB_DNA_textTH:311C4524cccccaggaaaatttagagtttgtgttctgatacttttcagcttccacgaagtttcaaagaattgaatattttccattaaaaagtgagaaaacagtgttttaaatttacgatgtgatcttttcagaacaaatattcgatgctcaatagtatttattcaataaacaaattcatttatttctttggacgttcagctccaatgatgactccacttccatatccacccccatatcctccacacttcttgcctccgcctccaggtaggaagattccagaagccgatgaaattgccaatatagcgaagatgaatacagaataaacgttcatagttgatgaagagaagatgagcttcttatgcttcgaacaacgatttcatgaatatttatacggtaggaaactgtcataacatttttatccaaattttattgaagtgtaggccacaataaatacttacagttttcgataaaatgttttattacaagtttaaattgcaaactgcttgttacagttttgcccgaagtttctg