Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:312B1   

TH:312B1RNAiTH:312B1
PCR_productTH:312B1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0280.7 Source_evidenceePCR1035WS150 Sequence/Annotation Release
Overlaps_Gene B0280.7 Source_evidenceePCR1135WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII71101697112074
Overlaps_transcriptB0280.7 Source_evidenceePCR1135WS150 Sequence/Annotation Release
WB_DNA_textTH:312B11906gtagccctgttttcagacgctgctattttaaagagtggagaaaaccaataagaacaacacaatacttagtttttatttttgagtcccaagaaaaagtttcgaatttttacaaataacaaaacaagtaaatgaaaatctgatatttagaatttgaacacagatttcaaagatttcttcttattttccggaagcttctcaacaattttgttctcttcgactgggcctagatcgtcaccgttactctcaacaattttgaattcttctaaagaattgtcacagatgtaaacattggtttgtggatgacacaggaagatacaatcacgggaaactggaacttcttggccaattggaagaatttcagttccgaggacgcatgctgaaaaggaaaaggttttgatatacacaaacaaaaaactaatcagtaataaaaaaaagacaaaatacaatctttcaatttggacgtgtacttacattccttaacaatatgtcgatagttacatctcatatttgcacccttcttcacatcagtccattgactagcatgagcatatgttttgttgtccattgtacaagccaattctgaaataatttaaattaatttagccgtgaagttgaacataccatcaacattagctgacttcaggctgacatgtccaaactctgactctacacatttcacatatgatccgtcgagaagttgtccaaattcatcgataagaactccgagtttgccaatcacacatcctgaaagtccacaaaaaaaattgaaagctagaaatctacagtgaccaaccaacaacgtgactttcatagtaactgtaatgcggacgaaaacattgcatgagacgtccatcaattgatgtatcatttggattgacttgtggttcaacccatttctcttcttctgggtagatcgtctcattgaaataacaaccagcagctgtaaataatgaactagttttttcgatttcatgaaacattcagagcttacctctctcaacgacctttttcaatgctccaccataaagattgcaatgtaaaatgacagttccattactgagacttcttgtctctcctggatgcattatttctccttgtgtatcaatacaagcaatcgcttcataattcaaaactccatcctctccttcttcacaagaaaatacaaagtcatgttggaaagttctctctcctggtttcaaatagttatcaccatcaacgttagtcggagcgcaacctagaaattcagagagtttgagaaaaataacattaaaagctaattgttcgttaaaaaaactatattttaaagaaacgattgtttggagatgttgaaaaaatgttttcatcatatttaatagcagctctgaaaaagaaacttctgaacgccaaaaacttgagttttaatcacattagacttacccaatggaacaatcttggcttttccttgatttccctcgaagatatattgaaacttgatgaaattctgtacccacgtctttttcaacacataaggttttgtgaaatttctatcaaaaactgctgcagaatcagcatattgcagacaaattacagctagaattgcagcaccaaggtttttcataatatgatgtttttcgaaataaatattccaatatagcatctcatttcaattggtcattttataccgtgtgtggtctgtagtctcttgtttgtcaacactatttcttgtagaggtgttgctttacgaactgtttagacagctttcagtgcagtggtcagttaaaataattaaatgaaaaacagcaggatgttattatacaaatgaaaaaatctatttatacatgtttacgaattcaaaaatgcaattcaaacgtaaatattaaccaacatgtgtgtttttagataaaaatttgaaattttggcaattcag