Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:312E9   

TH:312E9RNAiTH:312E9
PCR_productTH:312E9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (3)
Overlaps_Gene C02F5.14 Source_evidenceePCR245WS150 Sequence/Annotation Release
Map_statusBottom50_percentile_ePCRIII82324928234743
C02F5.6 Source_evidenceePCR1416WS150 Sequence/Annotation Release
Map_statusBest_ePCRIII82324928234743
C02F5.7 Source_evidenceePCR335WS150 Sequence/Annotation Release
Chunk_score Abs_score1357
Max_abs_score1357C02F5.7
Specificity_index0.512
Rel_score1
Map_statusBottom50_percentile_ePCRIII82324928234743
C30A5.2 Chunk_score Abs_score1292
Specificity_index0.488
Rel_score0.952
Overlaps_transcript C02F5.6b Source_evidenceePCR1416WS150 Sequence/Annotation Release
C02F5.14 Source_evidenceePCR245WS150 Sequence/Annotation Release
C02F5.7b.1 Source_evidenceePCR335WS150 Sequence/Annotation Release
C02F5.6a Source_evidenceePCR1260WS150 Sequence/Annotation Release
WB_DNA_textTH:312E92252gtacaagccaaggactactgatactgaaaaagacagatgtcggggtggatgacaaagaagaggcgggtagaactatgaagacgaaggtcgtttcaatggatgtggtggtggccaggtgttctgtttagtgtcagattcattctcaacctttatcgatgtctttattggttacgcttctggtttctgggtaaccaccgctctcactgaagttcgttctgttttgctcgcagatatttcaaaacttcactgccaatgacggaaaaaatattttaatgaaattttataatatgtcccattttgacactgttgtaaatagaaaatttctgaaaatattcaaattttcttcgttttcgtggcaaatcttaaatatttatcatctcctaaatatgtgagctaattggattttttgaataagagactaatgaatgattatatctgtgcatcctatttttcatcgaatttccgctctgacgtcagtaactgcagtaaacacgctcacttttccagcaactagtcggtgtgcactctcttgcttttcctacttttttcaattcttcagaaagacatgcgcttcgtttattcattctttttcccagaatatcttttatttcagatccattttatccacgagcaacgaatgtttttcttctaattttctccgtccatcatctatagtctcgtattgtgtttgaatccatggagacggctgaacgaataagtgctgcggcatctgcagcaagctcgagacgtgccaaaagattggctcaacaagctcataagactcatcctgtcattcaagccaaacaaaatcaggtaaaattttagtgatttttattttaaactataatacatagtttttttagatgtacttgattacgacgctttcaccagctcaagtcgataattctctaatcaatcgtgttctaccaaaggaagttctgctcaagtgagacattgatttataaagctgttataatcttcatcacatttcagagttttctcatttcttgacaccaaagccctctgtcgatcggctcaggtctgccgctcatggagcatacttgcgttggatggatctaactggcagcgcgtcgacttattcacatttcaaagagatgtcaaaactgcagttgtcgagaacttggcacgtcgttgtggaggattcttgaaggaactttcattgaaaggatgtgagaatgtgcatgattcagctctccgaacattcacatcgagatgtccaaatttggaacatttgagtctttatcgttgtaaacgggttaccgatgcgtcatgcgaaaacctaggtcgatactgtcacaagttgaattacctcaatttggagaattgctcatcaattactgatagagcaatgaaatatattgggtaactaaacgaagtttttatgcctttaaagtaaatttaaatttcagcgatggatgtccaaatttatcatatctcaacatttcatggtgtgatgctattcaggatcgtggtgttcagattattctctcaaattgcaagtcactcgatactctgatccttcgtggttgtgaaggacttactgagaatgtgttcggatctgtcgaagctcacatgggagctatcaagaaactgaatcttctgcaatgcttcgtaagcaaacattttaaatgaaacaattttcgataattactgttttcagcagctcaccgatattacagttcaaaatattgcaaatggagctaccgctttggaatatctgtgcatgtcaaattgcaatcaaatatctgatagatcattggtatctcttggacaacattctcataatttgaaagtactggaattatctggatgcacacttctcggagataatggatttattccacttgccagaggatgtcgtcaattggaacgacttgatatggaagattgttccctaatttctgatcacactatcaactcacttgcaaacaactgtacggctcttcgtgagctcagtctttcacattgcgaacttattacggacgagtcgattcagaatttagcctcgaaacaccgtgaaacgttgaatgttctggaacttgacaattgcccgcagttaactgattccacgttatctcatctgagacattgcaaagctctcaagagaattgatttgtatgattgccaaaatgtttcaaaagaagcaatcgttcgatttcaggtatgttatatttcatattacaaacttaaatacgattttattaaaaaatcaaaaacatctctgaaatcta