Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:314E8   

TH:314E8RNAiTH:314E8
PCR_productTH:314E8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C05D11.2 Source_evidenceePCR1404WS150 Sequence/Annotation Release
Chunk_score Abs_score1299
Max_abs_score1299C05D11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64345586436237
Overlaps_transcript (2)
WB_DNA_textTH:314E81680ccggacacaattcttttgcagcatctacagtaatccaggatctctataaagctattgatgattgtatctccactgcatgtgacacgtggcaacctgaagagcaaaagttgctactaaaagcggctcgattcggaatggcctacacaaacacaacgccagatactacgaaattaatgagagctatcaaagaaatccgagtgctaaatgaactaagaatggttcgcactggcatcccgctcactcatcgacaattcagggctattggagaaacctgcgtgataaacagacttatcgacatgggatcctatagtgttgcaattaaagttgctcaatggctcggcggagaaacaagtgaaaatgtagatcgagtgctcttagaatgggtcagaagatctattagtaaagtctcgaagagcaatatgaaaatggatcagccagcattagaagctttagatgaaaagatttctgcaaaattgcttcaatttcctcatgtttccattgccgatgcggctcgacgagcgattgaagcaaaacttccagaacttgcgaggctgttcattcgaagagagacagatgatgcaaaccatgtggcagtcttactccaactcaacgatgtttcagctgcactccagaaagcatcggcttctcagagaccacagttaattcatcaggtatatttttacatacaattaaaatatattggattttattttcaggttgtacgtcatctaatgaacagtgaaagtcgctcgagctatgagctcgcaatcagtcgaattccgcttgcccaatgtctataccaggatctcgttagacaagaaggtgaaactcgcggagcatcttcgagacaaatgttagcacttttggaacaagccagcgacttcgagagacaaactttattccattttgatgttgcagaaactgaaagaaatgtaagaattttatatttccttggttataaaaagcacacaagaagacaaagaaagaaaagctgcttacattagcatttattttttgaaatataaatttgatcctatcgtgaaaattttaaatttcctcaacttcagcccgatgaacgtttaaatgctctccgacgtgccaaggatgctgcaaaaagtatgggtgacaaggcaatcgaagagattctgaatgacgtcagcgcatttgctccactacaaattcaacggggacaagcagacatgtcagtgagggatacggtaattgagatggcacacgacactgcaaaggttgcacagttgaaacagcaagcaagattgactgataaacagttagtttaatcattatttaacatattttagcaacttttattttatagagttttgttatggacaatcgaaggattggctaaaaaaggaaaaatggagcagctgtttgatttggctcaaaaaagatctccaattggatatgctccattcgtcaaagcctgtgttcgatataaaagacttgacgagatcaagaagtattttgcaaaagttaatggatatccagatctggtggctgctcatcttgcaatgaagtaatagaaagttgaagaaataaatctaaaattcgaatgaaatttcagaaactacgtggaagctgccaagctggcctacgatcgccgagaccgtgatgtcttgcacgcagttcacatgaaatctcacgaagatcccacacaat