Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:321A2   

TH:321A2RNAiTH:321A2
PCR_productTH:321A2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R10E11.1a Source_evidenceePCR1065WS150 Sequence/Annotation Release
R10E11.1b Source_evidenceePCR1065WS150 Sequence/Annotation Release
Overlaps_Gene R10E11.1 Source_evidenceePCR1065WS150 Sequence/Annotation Release
Chunk_score Abs_score1002
Max_abs_score1002R10E11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII97718799773044
Overlaps_transcript R10E11.1b Source_evidenceePCR1065WS150 Sequence/Annotation Release
R10E11.1a Source_evidenceePCR1065WS150 Sequence/Annotation Release
WB_DNA_textTH:321A21166tcaagtcacttatcggcggtggagaagctggtgatagcgctgctggtggaacacgatatgaaagtatacaacgatgcatcgcttcactggttcatgcttgccaatgccgtgatgctaactgccgtcgtatgtcgtgtcacaagatgaagcgtgttgttcaacacacgaaaatgtgcaagaagaggatcaatggaacttgtccagtatgcaagcaactcatagcattgtgctgctatcatgccaaacattgtactcgagatgcttgtacggttccattctgtatgaacattcgtcagaagctcgccgagcagaagcgatcgcaacaacgaagagctgatatgatgatgagacgaagaatggaagggcttcaatcccatgttggtggagcggctccaactccgagtacagtatctaatggaactcccagtaatgcgccaacaccacctgtaagtgctggacctggtcccgctgtgaaaggaggtggagttggacaagtacaaatgcaacaacatcaaggaagtcatgtgggtggatcagggcctgcaggaatgggacaaccaatgaacagttttggtggaatgcctggaatgggtcttggtccaaacgcgcaaaatgggcctggattgcctgggatgaacccacaaatgaacgcgaatcagagtcgatatatgcgtaagttttcataattattttatcattttattaatagaatcgatttttcagctaatggaccaggattgggtcagtctggagctccgggacaacaacagcagccaatgtattcttctggtatgccaatgcaacgtccaggtggacttggtggaatgaatcctcaacaacaaccacaacaacaacaaggtcatcctggacttcaaaatccaggtggtcgtcctgggggagttcatggaatgggtcaaaatcagccagtcaggtaaatagcaaagatattatatatttggaaacaaactttaattatttcagaaataaccaagatatggtaatgaacatgcaaatgcaaaatcaacaccaacagccaccacctttcgattccacattgcaaccgcaaataatgaagatcaattctcgactgaaggcagcgaaaacggaggaagaacgggaaactgtattttcagaccttaagaagactccacatttgttccatgctt