Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:321H7   

TH:321H7RNAiTH:321H7
PCR_productTH:321H7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05B2.6 Source_evidenceePCR914WS150 Sequence/Annotation Release
Overlaps_Gene (12)
Overlaps_transcriptW05B2.6 Source_evidenceePCR948WS150 Sequence/Annotation Release
WB_DNA_textTH:321H71149aaaaaccgacgtaaccgaaggagattcatgtgtactgtgagaagaaataaaagagaaaaagaagaaattacgcaagattgaaatgaaatctgtttatttgatcggaagaaataaatctgacatttactttctgcgggttccgtcctcgaagaagactcctccgtcgatggcgcagtactttggacagattcccttctctccggcacctccagattgtcctggctgtcctggggctcctgggtttccgtcggctcctggctgtcctggggctcctgatggtccctttggtcctggggctccggcttgtcctggtcctcctggtgctcctggggatccagctggtcctggtggtccttgtggtccggcttgtcctggggcccctggagaagactcggattgagcgtcggatcctggttgtcctggggctccggcttgtcctgggtttcctggggctcctggggctccctttggtccagctggtcctggggctccggctcctgatccttgtccggcttgtcctggtgctccggcatctccttgtggtcctggggctcctggggctccagctggtccttgtgggcatggcttgcatggtggtggggtgattggctcacatggctgtgctggtgggcgtcctgggtttcctggaagtccagctgctcctggacgtcctggtcttcctggctttcctggggttccggctggtccagcggctcctggaaggcagcatccagagcatgatcctccttgggatccggtgtttccggtctcaacagcctcatcggttccatatccagcttgacgggcgaaacgggaagcgttctttggagatccacggatgtggttcacctcagcgaaaatgtcacgagcagagtgcttgcagaacttgatctcatggttgatctgggtcttgattccgtcaacatagttgtacaccaatggaagggtgatgcacagctgtaatattttcagttcaaagtttggtagcatttaaacaatttatataaactattctagaaaactagtgggcactgtatcctttgcagagtcaaagtcggagataacgtaccgagaaaacggcaacaaccgagaaggtaacagccgaataggcgacaaagcggtaagcctgaagacgttgcttctcgtcca