Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:322B2   

TH:322B2RNAiTH:322B2
PCR_productTH:322B2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59A2.4 Source_evidenceePCR670WS150 Sequence/Annotation Release
Overlaps_Gene F59A2.4 (3)
Overlaps_transcriptF59A2.4 Source_evidenceePCR677WS150 Sequence/Annotation Release
WB_DNA_textTH:322B21455caaagaaatgagcgaggagaatgttcaagagttcgttttgaaagaggactgtgagctgagatttgccgccggagacgattcggatgtctgtctggagctcgtcaagggatacgctgaaatttttggcacagaactgctgttaaataagaaatatacatttccagccagtaagttttcctcgaaatctggattttttttcaacttttcaaaaactcccgttttctggctatatttattgctctttctccgttttttttctgtaatatttcgcttgaaacactgttttcctaatgtttccgcagaaaaagcacaaatttctgtgaaattatcgacttttaggtcaatttccaagttttagcgtgtttctttgcggttaaagtagagaaattcgctgaaacttcatcttgaaacttggcctaaaaatcgataatttcagatgtaatcatttgttttatgcggaaaagtctggaaaacagtgttttaaatcaaatatcacagaaaaaaattgagaaacaccaatggatttggccataaaagtcaatttcggcccattttctgccatttaaaacccaatttttcctcagaatctcgtgtggcggcgttcacgtggaaaggcgccacaattgagctcgtcggcacaaccgagagcgcatacgttgccgagagcactccgatggtcatttatctgaatattcacgcagctatggaagaagttcggaagaagagagaggaacaggcggctggaaactcgaataaggcaaaaggaccgagattgctgttgggtgagctgattctaggctttttttggagatttttcgtcgaaaaactgaaaatttctgtggtttctgcaggaaaatcgagtaaaaatcatttgaaatactggaaaaatcaatattttcaaggggcgggggctatttgcaagcctggcacggttgttttgcaaccgtgccgcacggcccgcccacctttttattttattttttttcggaatttaagtaatttatttttatgtttggcttcgaaaaatgtagaaaaaaccttgttttccggttttttactgatttttaacccaaaaaataattaattttccagttggaccaacggacgtcggaaaaaccacagtctcccgtattctgtgcaactattcggttcgccaaggacgtaccccgatatttgtggagctcgatgtcggtcagaacagcgtttcggtgcccggaacagttgcagctgttcttgtacaaaaaacagccgacgtcattgatggattcgagagaaatcagccgattgtctttaatgtaggctttaaatttatcaaataattcacaatttttcccaattttttccagtttgggcacacttctccgtcggcaaatctatctctctacgaagcattgttcaaagagatggcaactacactaaatgcacaaattcaggagaatgatgaagccaaaatcg