Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:322H7_2   

TH:322H7_2RNAiTH:322H7_2
PCR_productTH:322H7_2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene C36A4.6 Source_evidenceePCR959WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Specificity_index0.424
Rel_score0.736
Map_statusBest_ePCRIII38501153851515
F42A6.4 Source_evidenceePCR959WS150 Sequence/Annotation Release
Chunk_score Abs_score812
Max_abs_score812F42A6.4
Specificity_index0.576
Rel_score1
Map_statusBest_ePCRIV33277083329105
Overlaps_transcript C36A4.6 Source_evidenceePCR959WS150 Sequence/Annotation Release
F42A6.4 Source_evidenceePCR959WS150 Sequence/Annotation Release
WB_DNA_textTH:322H7_21398ctcaaatctttccggttggaattcatccggcgattcccagtttgcagggttacggtggatggtgtgcggttggactttgagggttgaatctttggggtaaatctggccttgtattgtcatatcgttcagacagactcgattggtgaagctgaaaatattaacttttttgtgtattaaactaaacttccacatcaagaatttagagacttactgtgtagttggtggataaaacctcaaagattctttataaacacaatccgaatatttcatattatgtatggaatcataatttaatcctgcactttccttagttttcttgatttcttcatacaacttctgttgaactattggatattctgccaataggtatgcagaaaacatcattgcagtacttgttgtttcatatccagcaatcaaaaatgcgaaacagttttcaattacttctcgttttgtcatttttccgattgtttcccggcgaatgagaaggttcagaagatcagtgctgtcgtttccaccctctccagcacgtcttctgtcatatctgaattgagaaaatatacagtagtctctacaatctatgcgaaacctatttagtttgagagaaagcgttttcagtgggttaaccccgaataattctagctcctggaccattttgaaaaaaatgtcaatatttataaacaaaaatttcaaaagcctaaaattaaaggtgtacaaaatatcaacttacaagtcaactagccctttcacaagtggcaactcggctgccgaaagatcactgaatttgtatagaaacctccataaccatgaaagttctggaagtatcactgaaaatacgtttttaaaacaacaaaactacataattgaatagcaactcacaagacactggcaaaatccagctcttcttcaaggcaactgctccaacaaactttctggcttgcacataaaataggtcaattctatctctctggcaattactatcaattgcaaacgcacattttccaattatatcgagtgagaggctttggaaattgctgaaattacccaatgttcgaatttttgaaaaaaaaattaaaacttatttactcaaaaatatcccatttctgtccagaacttgatttttccttcaaaacctctaagaaaatatcaatttttgagacaagagtctcatgcattgctttcatttttcctgttgagaaaatcggagcaactgcagatcgagtatgcttccagccagttgcatacgtgttttggagcagagattggttcagctctacaattgattttattgcgtaggcaggtaggcaggcaggcacaagaaaggcgtttatgcctaccattgaaaaatgttcaacttacgattcatcccaaaaatgttaggagtcatgcgatccgaaaagt