Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:322H7_2   

TH:322H7_2RNAiTH:322H7_2
PCR_productTH:322H7_2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C36A4.6 Source_evidenceePCR959WS150 Sequence/Annotation Release
F42A6.4 Source_evidenceePCR959WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcript C36A4.6 Source_evidenceePCR959WS150 Sequence/Annotation Release
F42A6.4 Source_evidenceePCR959WS150 Sequence/Annotation Release
WB_DNA_textTH:322H7_21398ctcaaatctttccggttggaattcatccggcgattcccagtttgcagggttacggtggatggtgtgcggttggactttgagggttgaatctttggggtaaatctggccttgtattgtcatatcgttcagacagactcgattggtgaagctgaaaatattaacttttttgtgtattaaactaaacttccacatcaagaatttagagacttactgtgtagttggtggataaaacctcaaagattctttataaacacaatccgaatatttcatattatgtatggaatcataatttaatcctgcactttccttagttttcttgatttcttcatacaacttctgttgaactattggatattctgccaataggtatgcagaaaacatcattgcagtacttgttgtttcatatccagcaatcaaaaatgcgaaacagttttcaattacttctcgttttgtcatttttccgattgtttcccggcgaatgagaaggttcagaagatcagtgctgtcgtttccaccctctccagcacgtcttctgtcatatctgaattgagaaaatatacagtagtctctacaatctatgcgaaacctatttagtttgagagaaagcgttttcagtgggttaaccccgaataattctagctcctggaccattttgaaaaaaatgtcaatatttataaacaaaaatttcaaaagcctaaaattaaaggtgtacaaaatatcaacttacaagtcaactagccctttcacaagtggcaactcggctgccgaaagatcactgaatttgtatagaaacctccataaccatgaaagttctggaagtatcactgaaaatacgtttttaaaacaacaaaactacataattgaatagcaactcacaagacactggcaaaatccagctcttcttcaaggcaactgctccaacaaactttctggcttgcacataaaataggtcaattctatctctctggcaattactatcaattgcaaacgcacattttccaattatatcgagtgagaggctttggaaattgctgaaattacccaatgttcgaatttttgaaaaaaaaattaaaacttatttactcaaaaatatcccatttctgtccagaacttgatttttccttcaaaacctctaagaaaatatcaatttttgagacaagagtctcatgcattgctttcatttttcctgttgagaaaatcggagcaactgcagatcgagtatgcttccagccagttgcatacgtgttttggagcagagattggttcagctctacaattgattttattgcgtaggcaggtaggcaggcaggcacaagaaaggcgtttatgcctaccattgaaaaatgttcaacttacgattcatcccaaaaatgttaggagtcatgcgatccgaaaagt