Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:323B6   

TH:323B6RNAiTH:323B6
PCR_productTH:323B6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05B2.2 Source_evidenceePCR1125WS150 Sequence/Annotation Release
Overlaps_Gene W05B2.2 Source_evidenceePCR1125WS150 Sequence/Annotation Release
Chunk_score Abs_score1062
Max_abs_score1062W05B2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1096093210962580
Overlaps_transcriptW05B2.2 Source_evidenceePCR1125WS150 Sequence/Annotation Release
WB_DNA_textTH:323B61649tttttggcgttctcctctgacaacaaatactatatctcagcaccggactctgcctgcatatcctactagcacatcggctgctcgacgagcatctaatggggttccccgacttgttcagtgtcggctgatagttggcgccgcacaagttgttcatgagggtctggaaagaaggcggatgctgacaacacacaaaattcccgccactcgtggttttcagacaggtctccgagtcggagcacgacttcaagctggtaatgcacatttgtggatggtccagaggatttaagtacgggtgggggcattgaagatgctcaattgagctatgtacacacatttcgatgcaagccgtgtgatccgcaaaatggttctgagcagttgctccgtgagcatttccttttctataaaaattgaacgaatgacacgtgttggtctccgaatcgtagtaatatcggagcaacgagtcatcggattcttcctcgagctccggaatcggttgagcacaagctacttccttctggggacagcagtaattcttgtgacattcatatccggctccgcacattgagcatttttggactcgaattgacgggtaaacacgtgtcgggcagatatcttggatttctaggccacagcagatagagacagacccttgggcagtgcatttgtggaattccgggcagtcatcggtcgttgtgcattggaacacatccccatttagttttaggactttgtcgccttttgggcagcgatctgaaaccttgcaatgatcaattaaatcttgcaaaaataaataacctacagcgggactcgaaccctggtcttatgcgtcgcaggcaaagctctacccagttgagccactgccaaaaaagttacgctgcactaactgtccaggtggcccaaccgggtaaagagatggctataaatcaccgagccagggttcaagccctgttactggtttttacttttttcaagtttttaagacttacacctaggagtctgtttccttgacactacccccaactttctggtccgcaacggcattacgcgtttcaagctgggatgtcgacagcaaattccctttcgatctgtcgatttcttcatgcaaaaatgcgttttctggcatggattttccggatcgcagtaggttttggtgagctccacaattgagccaggtgggcatttggctagagcctggatttgtcgtgcctcacggcggcagcacacgaaacgagctttcacgtcggagtaaaggcagacggattggctggaaaagggtttctggctagctgggtgtcgaaccctggacgtttgcgtggtagccaactctttacccagttaagccaccgtggcaaattctgccaattaatttttcctaggtggctcaaccggggaagcagatgactacggagcacaagaccagggttcgagtcccaatggcggtttttcttttttttgtttcagttcttgcaaagtcatcttatctggtaccaagttccagggaaccttgacaacaaaattacacgtttcaaaaaaaaaattaagaaatgctcacccatcctgtccacaagtgttcttctccagcggagagcattgctcattgccagacttctcctcttcatatataaaagttgccggacaaacttcatcaa