Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:323C6   

TH:323C6RNAiTH:323C6
PCR_productTH:323C6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05B2.5 Source_evidenceePCR915WS150 Sequence/Annotation Release
Overlaps_Gene (11)
Overlaps_transcriptW05B2.5 Source_evidenceePCR1010WS150 Sequence/Annotation Release
WB_DNA_textTH:323C61513gcttgtcattggcatcagtactttccgtctaaaaccagattacatttgaagcttattcattaataactttaagaattcctttacaccaataaattgagagagaacgcgatttttagctgtgatatagtattttgattggtttttgtagtttcccgatttatacaataaaatcatggtaaatttttgccagatgaggtttcaaagcaattacaaaacaatttcagagattcagggtgtcactaccttgtgacacatacaaccagcattaatcccgatagaatataagtcgtttattgggattataagttgtgttcttacaatttttactttgatataattaaataactgacgtattgcttcgtgttgtattaattatgcttaaatagatttccagtttcaaaaaccacaagtaataagacctgtcaaataaattctttaaagaaattgaaaaattgaaatgaaatgtttttattcgattaaaaatgactagacggtaaagaactaaatcttcctgagtgtttactttctgcgggttccgtcctcgaagaatactcctccgtcgatggcgcagtactttggacagattcccttctctccggcacctccagattgtcctggctgtcctggggctcctgggtttccgtcggctcctggctgtcctggggctcctgatggtccctttggtcctggggctccggcttgtcctggtcctcctggggctcctggggatccagctggtcctggtggtccttgtggtccggcttgtcctggggctcctggagaagactcggattgagcgtcggatcctggttgtcctggggctccagcttgtcctgggtttcctggggctcctggggctccctttggtccggctggtcctggggctccggctcctgatccttgcccggcttgtcctggtgctccggcatctccttgtggtcctggggctcctggggctccagctggtccttgtgggcatggcttgcatggtggtggggtgattggctcacatggttgtgctggtgggcgtcctgggtttcctggaagtccagctgctcctggacgtcctggtcttcctggctttcctggggttccggctggtccagcggctcctggaaggcagcatccagagcatgatcctccttgggatccggtgtttccggtctcaacagcctcatcggttccgtatccagcttgacgggcgaaacgggaagcgttctttggagatccacggatgtggttcacctcagcgaaaatgtcacgagcagagtgcttgcagaacttgatctcatggttgatctgggtcttgattccatcaacatagttgtacaccaatggaagggtgatgcacagctaaaatattccatattcaattaactaaaatgtagagtgcaaagaattcaaacttaccgagaaaacggcgacaaccgagaaggtaacagccgagtaggcgacaaagcggtaagcctgaagacgttgttgctcctccattgcaataaagatgggcaagtgc